1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helen [10]
3 years ago
8

Debris from the west coast of the U.S. Often collects in the Great Pacific Garbage Patch. What are the most likely impacts to ma

rine life in this area?
Biology
1 answer:
vivado [14]3 years ago
7 0

Answer:

a

Explanation:

ee4rr

rjyu5hgrrfftfg6

You might be interested in
How are Earth’s organisms and crust interdependent?
sattari [20]
The Lithosphere contains all of the cold, hard, solid rock of the planet's crust, the hot semi-solid rock below the crust, the hot liquid rock near the center of the planet, and the solid iron core. The biosphere is the sphere that contains all of the Earth's living organisms. The organisms and crust interact through events between spheres, such as natural events like floods, shifts in the Earth's crust. Some event as such could create soil erosion resulting in decreased vegetation and increase death of organisms. <span>
</span>
5 0
3 years ago
Read 2 more answers
How is the flow of matter and energy through an ecosystem connected to the carbon and nitrogen cycles?
Assoli18 [71]

Answer:

when organisms use organic matter for cellular respiration all that matter goes back into carbon dioxide, water, and minerals, while ALL the energy leaves the ecosystem as heat.

Explanation:

3 0
3 years ago
Which gas is forming in the tube shown below
USPshnik [31]
Where is the picture???
8 0
3 years ago
Read 2 more answers
Your ability to feel the physical enjoyment of a hot bath is most likely to be stopped by injury to your: angular gyrus hippocam
Sholpan [36]

Answer:

hippocampus

Explanation:

the hippocampus could be the likely part of the brain that is affected

8 0
3 years ago
I don't understand this can u help me for the answer?
sergey [27]
5 is adaptation, 7 is transpiration
6 0
3 years ago
Other questions:
  • ______________ chemically alter the make-up of nutrients, changing them into a form that can be readily used by cells.
    10·2 answers
  • What does metabolizing mean?
    10·2 answers
  • Describe how viruses and prions can alter cell functions
    12·1 answer
  • BRAINLIESTTT ASAP!!
    14·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How many autosomes does a human female have? <br> What are her sex chromosomes?
    13·1 answer
  • What causes the greenhouse effect
    11·2 answers
  • The process by wich a solid changes to a liquid is
    7·2 answers
  • Protein electrophoresis lab
    7·1 answer
  • What does the R stand for when attached to a molecule?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!