1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dexar [7]
3 years ago
11

Square 1 has a side length of x, and square 2 has a side length of y. Square 2 is formed by joining the midpoints of the sides o

f square 1 in order. If x = 2, find the ratio of the area of square 1 to the area of square 2.
Mathematics
2 answers:
earnstyle [38]3 years ago
7 0
I believe is will be 1:2<span />
marishachu [46]3 years ago
6 0

Answer:

The ratio of the area of square 1 to the area of square 2 is 4:1.

Step-by-step explanation:

Area of a square can be calculated by; A = length × length

For square 1, area A = 2 × 2

                                 = 4

Since square 2 is formed by joining the midpoints of the sides of square 1, thus y = 1.

Area of square 2 = 1 ×  1

                            = 1

Thus the ratio, \frac{A_{1} }{A_{2} } = \frac{4}{1}

                     

Therefore, the ratio of the area of square 1 to the area of square 2 is 4:1.

You might be interested in
How do we express four less than the square of a number?
Gre4nikov [31]

Answer:

x^{2} - 4

Step-by-step explanation:

in this case, x is your number. we will always note square with the tiny two at the top of the number.

Four less than anything is easily shown with a minus four.

eg. four less of 12 square:

12^{2}  - 4 = :)

4 0
3 years ago
The interior angles formed by the sides of a quadrilateral have measures that sum to 360°.
hammer [34]

Answer:

<em>x = 59</em>

Step-by-step explanation:

<u>Equations</u>

The interior angles formed by the sides of a quadrilateral have measures that sum to 360°.

The image shows a four-sided polygon and its four angles measures, thus we sum them all and equate the sum to 360:

x + x + 2x + 3 + 2x + 3 = 360

Simplifying:

6x + 6 = 360

Subtracting 6:

6x = 354

Dividing by 6:

x = 354/6

x = 59

5 0
3 years ago
Read 2 more answers
Which list of numbers is shown on the number line below?
almond37 [142]

Answer:

is A

Step-by-step explanation:

Negative 2.5, 1 and three-fourths, 50 percent, 1.5

Pls Mark Brainliest

5 0
2 years ago
A penguin is standing 3 feet above sea level and then<br> dives down 10 feet. What is its depth?
ValentinkaMS [17]

Answer:

7 feet below sea level

Step-by-step explanation:

he was at 3 then you subtract 10 feet because he dives.

7 0
3 years ago
Read 2 more answers
PLZ HELP IVE BEEN STUCK ON THIS QUESTION​
o-na [289]

Answer:

A= 16

B=?

Step-by-step explanation: srry about the second one im also confused but i tried my best.

7 0
3 years ago
Other questions:
  • Please help me solve this!
    12·1 answer
  • Last week a store sold laptops worth a total of $10885 each laptop cost $1555 how many laptops did the store sell last week?
    13·2 answers
  • What is 11 times one fourth
    8·2 answers
  • What does "co-terminal" mean?
    9·1 answer
  • Solve each inequality, graph the solution on the number line, and write the solution in interval notation
    8·1 answer
  • Help help help help help
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Find the equation of the line that passes through the points (4,1) and (-4, -5)
    8·1 answer
  • Please help me complete the table then graph
    6·1 answer
  • Sally's goal is to collect between 900 and 1,000 seashells. Write and solve a
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!