1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bezzdna [24]
4 years ago
12

What does genotype mean?

Biology
2 answers:
alisha [4.7K]4 years ago
7 0
Genotype is one of three factors that determine phenotype, along with inherited factors, epigenetic factors and non-inherited environmental factors.
Aleks04 [339]4 years ago
3 0

Answer:

Genotype is collection of genes which is responsible for different genetic traits.

Explanation:

You might be interested in
Sample Question:
Brilliant_brown [7]

Answer:

d. Their bonds

Explanation:

4 0
4 years ago
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
The germ theory of disease states that many diseases are caused by the presence and action of specific
Amanda [17]
The germ theory of disease states that many diseases are caused by the presence and action of specific <span>microorganisms.</span>
3 0
4 years ago
Read 2 more answers
What is the difference between global warming and climate change
artcher [175]

Answer:

global warming is the long term rise of the average temperature of the earths system and climate change is the major changes of temperature while global warming is not.

Explanation:

5 0
3 years ago
A carbohydrate-rich meal 3 to 4 hours prior to competition benefits an endurance athlete in which of the following ways?A. Maxim
Anit [1.1K]

Answer:Option D

Explanation:

The carbohydrates rich meal will help the athlete in competition as it will help in increasing the endurance of the body.

A carbohydrate rich meal will increase the glycogen stores in the muscles and liver which will increase the ability of the athlete.

The reserves will allow more aerobic respiration which will increase the efficiency of sportsman.

hence, the correct answer is option D

8 0
4 years ago
Other questions:
  • Which fertizer element is of most concern environmentally?
    15·1 answer
  • In a car accident, Jane suffered a chest injury that resulted in impaired breathing and respiratory acidosis. How will her body
    12·1 answer
  • How does the principle of independent assortment apply to chromosomes?
    5·1 answer
  • If you help quick I will give BRAINLIST!
    13·1 answer
  • What do you think really happened to the people of Easter Island?
    14·1 answer
  • 6CO2 + 6H2O -&gt; C6H12O6 + 6O2
    12·2 answers
  • Include answers for part A and B.
    14·1 answer
  • What are the three things viruses have in common
    13·2 answers
  • Pls help, this is science btw.
    10·1 answer
  • If a hotel polluted water with its waste, how will this most likely affect the birds that eat the fish living in the polluted wa
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!