1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makkiz [27]
3 years ago
11

A child with a body mass index (bmi) equal to or greater than the 85th percentile, but less than the 95th percentile, is:

Biology
1 answer:
Vilka [71]3 years ago
5 0
About the 90th percentile
You might be interested in
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Why processing of fish and shellfish is neede?
aleksklad [387]

Answer:  The operations of importance in fish processing are washing, degutting, salting, fermentation, drying, and smoking. These operations contribute to the development of flavor, texture, color, and improved storage characteristics of the products.

Explanation:

7 0
3 years ago
How is a viral antigen, like EBV, recognized by T cells? A. An antigen fragment is presented within class I MHC to the T cell re
aniked [119]

Viral antigens like EBV are usually recognized by T cells involving an antigen fragment present within class I MHC to the T cell receptor.

Ebstein Barr Virus

The Epstein-Barr virus is a human herpes virus with unusual biological characteristics.

  • It lives in practically every human person in a dormant condition in resting memory B lymphocytes
  • It is also a strong transforming virus in vitro for B cells and is linked to numerous significant lymphomas, including Burkitt's, Hodgkin's disease, and immunoblastic lymphoma.

With the exception of the memory compartment, each stage of the cycle has been shown to be possibly controlled by the immune response.

Epstein-Barr virus (EBV), commonly known as human herpes virus 4, is a double-stranded DNA herpes virus that is extensively spread. It is the cause of infectious mononucleosis.

  • EBV is most usually transmitted by body fluids, particularly saliva. EBV, on the other hand, can transmit by blood and sperm during sexual intercourse, blood transfusions, and organ transplants.

EBV can be transferred by utilizing materials that have recently been used by an infected individual, such as a toothbrush or a drinking glass.

  • The virus is likely to survive on an object for at least as long as it is wet.
  • When you initially get infected with EBV (primary EBV infection), you might spread the virus for weeks or even months before you notice any symptoms.
  • Once the virus has entered your body, it remains dormant.

Hence, the correct answer is option A

Learn more about EBV here,

brainly.com/question/12926983

# SPJ4

8 0
1 year ago
Hi please help i’ll give brainliest
klasskru [66]

Answer:

Explanation:

13.5 billion years

4 0
3 years ago
Read 2 more answers
3. What charts, tables, or drawings would clearly show what you have learned in this lab? lab of modeling water erosion
neonofarm [45]

Answer:

appropriate labels

Explanation:

to label everything correctly

5 0
2 years ago
Other questions:
  • which of these is NOT true of cells?a. they are much like empty rooms.b. they were first discovered in the 1600sc. they can be f
    6·1 answer
  • The resistance of an object to a change in the speed or the direction of its motion
    9·1 answer
  • Assume that a single layer of phospholipids coat the water in a beaker. which part of the phospholipid molecule will face the ai
    6·2 answers
  • Based on the diagram, which three consumers all get their energy from the same producer?
    9·1 answer
  • Carbon dating is accurate only for objects less than 60,000 years old. Use the idea of half-life to explain this limitation.
    9·1 answer
  • The function of platelets is all of the following except:
    12·1 answer
  • Macromolecules are nucleic acids which are the source of __________ energy?
    11·1 answer
  • Please help its worth 50 points
    14·1 answer
  • 1. Which of the following structures makes cyanobacteria optimal symbionts for eukaryotic organisms needing oxygen and nutrients
    15·1 answer
  • How do prokoryotes benefit animals
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!