1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Effectus [21]
3 years ago
13

If plants disappeared how long would oxygen last

Biology
1 answer:
lisabon 2012 [21]3 years ago
6 0
I’d say probably about 1-4 weeks
You might be interested in
How do you introduce your qualities in a letter asking what you want to be when you're older
labwork [276]
<span>You can introduce your qualities in a letter by being casual. You’re writing this letter to yourself, so don’t feel you have to take a formal tone. Write as though you are talking to your best friend. When talking about your current self in this letter, use “I” language. When talking about your future self in this letter, use “you” language. <span>Summarize the important things of yourself. Your letter should start with a quick reminder of who you currently are. Think about mentioning your recent accomplishments, such as a 4.0 GPA, and current interests, including extracurricular activities. This will allow you to see how much your life has changed since you wrote the letter.</span>
</span>

6 0
3 years ago
Which makes viral infections difficult to defeat?​
bulgar [2K]

Answer:

needles used and scars

Explanation:

4 0
3 years ago
Give the seven levels of obligatony catagories​
kotykmax [81]

Answer:

There are 7 obligate categories included in hierarchical classification The highest rank is the kingdom, followed by division, class, order, family, genus and species.

Explanation:

Hope this help!!

7 0
2 years ago
Read 2 more answers
Where are the 2 places that you can find the organelles Ribosomes
Zigmanuir [339]

Answer:

Ribosomes are found 'free' in the cytoplasm or bound to the endoplasmic reticulum (ER) to form rough ER. In a mammalian cell there can be as many as 10 million ribosomes. Several ribosomes can be attached to the same mRNA strand, this structure is called a polysome.

Explanation:

Hope this helps :D

3 0
3 years ago
Why is it important for plants to “hold enzymes in their functional shapes”
Svetllana [295]
<span> because if the shape of the enzyme changes it may not function or it may function differently.
hope this helps</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • How does biology relate directly to your own life
    6·2 answers
  • Why did Europeans call the bubonic plague the Black Death? because that is what the Chinese called it because of the black boils
    8·2 answers
  • 1. Suppose a dominant allele (N) codes for a big nose and a recessive allele (n) codes for a small nose. Imagine that an organis
    15·1 answer
  • How does a leaf take in water
    7·2 answers
  • Which of the following statements regarding Entner-Doudoroff pathway is true?
    6·1 answer
  • You are conducting an experiment on the effects of fertilizer on the growth of three types of plants, all grown from seed. Multi
    7·2 answers
  • The ETS reactions produce ATP from ADP using the energy provided by which two molecules?
    10·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • During an experiment, if you purposely change the temperature to test a hypothesis, the temperature is called the a. manipulated
    7·2 answers
  • I need help with this asapp
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!