1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Norma-Jean [14]
3 years ago
7

Which form of natural selection on polygenic traits results in the creation of two distinct phenotypes? A. Directional selection

B. Disruptive selection C. Stabilizing selection D. Artificial selection
Biology
2 answers:
Andrew [12]3 years ago
7 0
I think it is
B.<span>Disruptive selection. </span>
mojhsa [17]3 years ago
5 0

Answer;

-Disruptive selection

Disruptive selection results in the creation of two distinct phenotypes.

Explanation;

-Disruptive selection is a type of natural selection that selects against the average individual in a population. The make up of this type of population would show phenotypes of both extremes but have very few individuals in the middle.

-The variance of the trait increases and the population is divided into two distinct groups. The disruptive selection will cause organisms with intermediate traits to reproduce less, and will allow those organisms with extreme traits to reproduce more.

You might be interested in
What process changes an organism by introducing novel DNA into the organism?
kirill115 [55]

Answer:

Recombinant DNA

Explanation:

Recombinant DNA introduces foreign or new DNA into an organism that may cause a change.

8 0
3 years ago
How is energy released from ATP?<br> ANSWER CHOICES IN THE PIC
lana [24]

Answer:

Explanation:

When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate (ADP). Likewise, energy is also released when a phosphate is removed from ADP to form adenosine monophosphate (AMP).

3 0
2 years ago
How are excited electrons from stage 1 used in stage 2 of photosynthesis. A. carbon fixation B. splitting by water C. formation
Natalija [7]
Your answer is D. Formation of NADPH
I took the test and got the same answer
4 0
3 years ago
Read 2 more answers
Stem cells can form many kinds of cells. In contrast, most body cells cannot form different types of cells. For example, skin ce
DedPeter [7]

Explanation:

i think it is D, or maybe its C.

5 0
3 years ago
Consider the case of in vitro evolution used to generate RNA molecules with ligase activity. If the researchers repeated the inv
nekit [7.7K]

Answer:

The answer is E.

Explanation:

In vivo or in vitro evolution (Directed Evolution) is a technique used by genetic scientists to push the change in nucleic acids or proteins in a specific direction to get the end results that they want.

And high-fidelity polymerase is used to get a replica of the target DNA that has less errors.

So the situation given in the question where researchers use a higher-fidelity DNA polymerase in vitro evolution, the mutation rate would most likely be lower because of the high-fidelity DNA polymerase.

I hope this answer helps.

4 0
3 years ago
Other questions:
  • What event was most responsible for the U.S. Congress's passing the National
    10·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Intestinal virome changes precede autoimmunity in type i diabetes-susceptible children. 2017. proc natl acad sci u s
    7·1 answer
  • You push a heavy crate. at first it doesn't move. you push harder, and it finally starts to move, but you still have to exert so
    7·1 answer
  • C) Why are vaccines important in preventing infections of more dangerous viruses?
    15·1 answer
  • ____ is a hormone secreted by the pituitary gland that stimulates ovulation or testosterone secretion.
    10·2 answers
  • Which plant groups do male gametes depend on the water or moisture to swim towards the ovum
    6·1 answer
  • Why do certain bacteria become endospores?
    7·1 answer
  • Which correctly lists three planets that have rings?
    7·2 answers
  • A biome that has a large amount of rainfall, high temperature, and poor soil is a...
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!