1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andru [333]
3 years ago
9

Which event is caused by gravity with water

Biology
2 answers:
Bond [772]3 years ago
8 0

Erosion is your answer

belka [17]3 years ago
7 0
they correct answer is erosion
You might be interested in
Which of the following is an example
lisabon 2012 [21]

Answer:

B

Explanation:

soil being depleted to nitrogen due to high runoff

4 0
3 years ago
Read 2 more answers
2 Explain why fossil fuels contain large amounts of carbon compounds.
Korvikt [17]

Fossil fuels release carbon dioxide gas when they burn which adds to the greenhouse effect and increases global warming. Of the three fossil fuels, for a given amount of energy released, coal produces the most carbon dioxide and natural gas produces the least.

Did this help?

4 0
3 years ago
What is the term for water that moves across the surface of the land and enters streams and rivers?
White raven [17]

Answer:

Its the hydrologic cycle

Explanation:

Hopefully this helps!!! Im srry if it isn't

8 0
3 years ago
Read 2 more answers
Which of the earth's systems makes up all the living organisms found on earth?
den301095 [7]
It's the lithosphere
7 0
3 years ago
When will exposure to a potentially harmful substance be most likely to damage many organs in a developing embryo
Alex17521 [72]
A developing embryo is typically more susceptible to damage/injury during the early stages of pregnancy.
6 0
3 years ago
Other questions:
  • WILLLGIVE A BRAINLEST
    7·2 answers
  • What is the function of white blood cells?
    12·1 answer
  • 1. The sensory layer of the eye.
    7·2 answers
  • Which is the main goal of hiv treatment? to keep the person's t cell count as low as possible to completely cure the person of t
    5·2 answers
  • Which of the following are the 3 factors of Sustainability?
    14·1 answer
  • Which of the following is not true of conservation tiling? A. a method of cultivation in which residues from previous crops are
    15·1 answer
  • Genetic and chemical modifications are often performed on antimicrobial drugs. Which of the following statements explains the ad
    10·1 answer
  • Which statement is FALSE about DNA and RNA?
    15·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What season is it in the Southern Hemisphere in January
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!