1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa05 [86]
4 years ago
6

TRUE OR FALSE:

Biology
2 answers:
Neko [114]4 years ago
8 0
1.true
2.true
3.fasle
4.true
5.false
6.true
Elan Coil [88]4 years ago
8 0
The answer is a bsf
You might be interested in
Which of the following best explains what would happen if there were no decomposers in an ecosystem?
azamat

Answer:  if there were no decomposers in an ecosystem then, wastes and the remains of dead organisms would pile up and the nutrients within the waste and dead organisms would not be released back into the ecosystem.

Explanation:

5 0
3 years ago
What muscles are not under voluntary control?
KatRina [158]

Answer:

I believe the answer is d

4 0
4 years ago
Which statement is true about lethal genes?
Korvikt [17]
I'm not completely sure, but I'm fairly certain that the answer is B.
7 0
3 years ago
What is the main reason that governments create natural areas called reserves?
RSB [31]
I believe it is D, to protect weakened ecosystems and their wildlife
8 0
3 years ago
Read 2 more answers
There are many different types of scientific investigations, including controlled experiments, observational field studies, the
ArbitrLikvidat [17]

Eyyy we both Supreme!


Yo answer is A. Sorry about the wrong answer.

5 0
3 years ago
Read 2 more answers
Other questions:
  • 17. Which of the following does not accurately describe fruits? A. Fruits attract animals, which helps disperse seeds. B. Fruits
    10·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Who should decide what types of energy sources should be developed?
    12·1 answer
  • Which organisms on the geologic time scale are now extinct?
    7·1 answer
  • A scientific theory can be incorrect but still be considered a good scientific theory. How can this be?
    7·2 answers
  • Both whales and clown fish live in oceans. Whales are classified as mammals and clown fish are classified as fish. Which charact
    8·2 answers
  • In _____ reprodction, individuals are produced by the fusion of gametes
    7·1 answer
  • Bloom syndrome is an autosomal recessive disease that exhibits haploinsufficiency. A recent survey showed that people heterozygo
    10·1 answer
  • The picture below shows the devils Millhopper sinkhole in Florida.
    12·1 answer
  • In a properly executed Gram stain, Gram positive organisms appear ________ while Gram negative organisms appear ________.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!