1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elis [28]
3 years ago
9

Positive and negative environmental stimuli that motivate behavior are calledA)needs.B)incentives.C)instincts.D)drives

Biology
1 answer:
Lady_Fox [76]3 years ago
5 0

Answer:

(D.) Drives

Explanation:

The idea that a physiological in a positive and negative environmental stimuli that motivate behavior creates an aroused tension state (a drive) that motivates an organism to satisfy the need for glucose.

You might be interested in
A 2-month-old infant experiencing severe diarrhea is prescribed intravenous fluid replacement. before adding potassium to this s
lorasvet [3.4K]

The nurse should check if the 2 - month old infant has voided.

This should be done because kidney function may fail with diarrhea. So, it is important to check if the kidney functions properly before adding potassium (to prevent hyperkalemia).


6 0
2 years ago
Which type of biomolecule are the enzymes that carry out DNA replication? the choices are Carbohydrates Lipids Proteins Nucleic
ollegr [7]

Answer:

Nucleic Acid

Explanation:

6 0
3 years ago
Read 2 more answers
The nutritive value of sunflower seeds a brief note
Mice21 [21]
<h2>Nutritive Value if Sunflower Seeds are:--</h2>

100 grams of these seeds give around 585 calories of energy.

They have a good amount of fibre (8.5 g) and fats (51.5 g). Fats present are mostly polyunsaturated and monounsaturated; which are good fats

They are also rich in protein (20.77 g).

6 0
2 years ago
A white woman says she is not racist but avoids sitting near Black individuals. She has
lisov135 [29]
I believe it is A
Please make this the brainliest answer
6 0
2 years ago
How do you know that matter is conserved during the process of cellular respiration?
kow [346]
C hope that helps have a great day :))))
8 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Describe the importance of the inner membranes separating different regions of the mitochondrion and the chloroplast.
    5·2 answers
  • In which large group of cells does most of the photosynthesis occur in a leaf?
    9·1 answer
  • How does gel electrophoresis work?
    14·1 answer
  • Which of the following is a parasitic worm? a. leeches b. hookworms c. planaria d. flukes
    8·2 answers
  • Write the importance of thermometers. ​
    8·1 answer
  • ASAP please!!! Brainiest if correct!
    14·1 answer
  • Each of the bird's beaks was adapted to the type of ...
    14·1 answer
  • Remnants of osteons, which have been almost completely recycled by osteoclasts, are known as __________
    9·1 answer
  • According to the bell-magendie law, ______________________ exit from the ventral horns of the spinal cord, and sensory informati
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!