1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
swat32
3 years ago
14

Why does the word antibiotic suggest that these medications would be ineffective against viruses?

Biology
2 answers:
kari74 [83]3 years ago
5 0

Answer: The word bio in the word antibiotic suggests that antibiotics kill living things. Viruses have genetic information, but they don’t have cells. They don’t fully meet the definition of being alive.

VashaNatasha [74]3 years ago
3 0
Antibiotics are ineffective against viruses because viruses do not have cells. Viruses are infectious agents that live within the cells of other living things. Antibiotics work by breaking down the cell walls of bacteria or interfering with the bacteria's ability to repair its cell's DNA, according to How Stuff Works.
You might be interested in
What 2 things are produced by neutralization
LUCKY_DIMON [66]

neutralisation is the process of converting an acid or a base into the pH value 7.The 2 things produced r hydrogen gas and a salt.

acid+base=salt+hydrogen gas.This often occured in your stomach. when you have gastroble you are eating tablets which are base and a reation take place with hydrocloric acid in it

hope it helps


6 0
3 years ago
(2) Using the image shown on the slide: How do you think the arctic halocline lavers of
lapo4ka [179]
Can I see the image ...
4 0
3 years ago
Imagine that you move a substance from one container to another and its volume changes. what state of matter is that substance
Marina86 [1]
Gas, researched it. thanks
5 0
3 years ago
Drag each label to the correct location.
11Alexandr11 [23.1K]

Answer:

Box 1: AA

Box 2: Aa

Box 3: AA

Explanation:

In order to figure out the pedigree, you first have to do a punnet square- kind of like cross-multiplying. EX: For the first box: Aa x AA

For box one, we know that it is Aa, and not AA, because box 2 has to be AA.

We know that because Aa X Aa would give us some "aa" offspring which we do not see in the last generation (see 2nd pic). The only way to get no "aa" offspring is to have an AA X Aa cross.

6 0
3 years ago
Describe your plan to determine if the paths of past hurricanes can help determine the paths of past hurricanes
elixir [45]
The question does not make sense please type in comments and tell me
5 0
3 years ago
Other questions:
  • How do decomposers return nutrience into the ecosystem
    9·1 answer
  • Why are archaea in a different domain from bacteria?
    12·2 answers
  • Is plants eukaryotic or prokaryotic?
    7·1 answer
  • When paleontologist refer to the "Big Five" to what are they referring?
    9·1 answer
  • Which of the following is not a process that wears down or build up Earth's surface?
    10·1 answer
  • What is a black banded sea snake's lifespan? How do they take care of their young? Please explain in details.
    10·1 answer
  • Some studies have indicated that our eyes naturally travel from bottom left to top right, so putting the diagonal along that pat
    5·2 answers
  • What type of cells in placozoans help with the digestion of food?
    6·1 answer
  • Which trait is unique to birds?<br><br> Flight<br> Wings<br> Endothermic<br> Feathers
    14·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!