1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inn [45]
3 years ago
15

Which parental responsibilities would be the most interesting to you? why?

Biology
1 answer:
gavmur [86]3 years ago
7 0
Parents have many responsibilities to their children, these responsibility must be taken seriously in order to keep the children in the right path. The parental responsibility that I will personally found very interesting is teaching my children how to do different stuffs. Like teaching them cook different dishes and cookies or teaching them to play different games or teaching them funny tricks in mathematics.
You might be interested in
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
A coyote chases a jackrabbit. Which process gives the coyote the energy it needs to chase the jackrabbit?
777dan777 [17]
The process that is detailed here, is knows as the Adrenaline Process, Or (Adrenaline). Adrenaline gives the body an extra boost of energy when in a hurry, in shock, or scared.
8 0
3 years ago
Read 2 more answers
"you discover a new living organism. it does not have a nucleus, nor does it have any other membrane-bound organelles. it lives
-Dominant- [34]
It would belong to the bacteria domain.
3 0
3 years ago
How is a scientific law different from a scientific theory?
Lelu [443]
Answer is c have a good day
3 0
2 years ago
Read 2 more answers
Plants make sugar molecules. What are the necessary ingredients for plants to make the sugar molecules? Group of answer choices
777dan777 [17]

Answer:

Explanation:

Produce it using sunlight carbon iv oxide

And water(moisture)

4 0
3 years ago
Other questions:
  • What type of wave is created by solar energy? Physical mechanical terminal electromagnetic
    12·2 answers
  • Which are homogeneous mixtures? Check all that apply.
    14·2 answers
  • What might the continued burning of fossil fuels do for future generations?
    13·2 answers
  • Cerebral aneurysm is most frequently the result of a. subarachnoid hemorrhage. b. subdural hemorrhage. c. meningitis. d. embolic
    6·1 answer
  • Help please and thank you
    5·2 answers
  • In 3-5 sentences, relate the impact of the industrial use of water for hydraulic fracturing (fracking) with the availability and
    14·1 answer
  • Precipitation:
    13·1 answer
  • When a chicken with black feathers mates with a chicken with white feathers, their offspring may be a speckled hen. Half of a sp
    6·2 answers
  • Which substance in green plants needs to absorb sunlight during photosynthesis?
    15·1 answer
  • The portion of the mRNA molecule that is translated is composed of.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!