1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blababa [14]
4 years ago
14

Latrotoxin, produced by the poisonous black widow spider, increases the release of acetylcholine. how do muscle cells respond?

Biology
1 answer:
dangina [55]4 years ago
4 0

<span>Latrotoxin produced by widow spider affects muscle nerve endings. This toxin forms pores on the membrane of the cell. As a consequence, an influx of Ca+ ions occurs and bursts of the neurotransmitter acetylcholine (Ach) are released. Ach induces an increase in neuromuscular activity that leads to painful skeletal muscle spasms and later even paralysis.</span>

You might be interested in
What is the growth habit of pecan, peach, water oak, loblolly pine, long leaf pine, and sugar maple trees?
Elodia [21]

near water or some kind of body of water

:)

3 0
3 years ago
Find the arc length of a circle that has a 6-inch radius and a central angle that is 65 degrees. Use 3.14 for π and round your a
Setler [38]
The arc length is calculated by using the equation below:

Arc length = 2πr ( C/360)

where r is the radius and C is the central angle.

<span>Arc length = 2π(6) ( 65/360)
</span>Arc length = 6.81 inches

Therefore, the correct answer is option C.
4 0
3 years ago
Based on what you have read, which of the following statements about endemic species is correct?
nlexa [21]

Answer:

A and C

Explanation:

6 0
3 years ago
Dino and his family live in a community where people just throw their garbage anywhere. Recently, Dino was hospitalized due to d
jok3333 [9.3K]

Answer:

The main measure that must be taken to alleviate this situation is the proper disposal of garbage in the community in which Dino lives.

Explanation:

Inadequate disposal of garbage can cause a series of very serious illnesses and accidents to the entire community, which reinforces the need for all residents of a community to promote the proper disposal of waste. This is not happening in the community where Dino and his family live.

The inadequate disposal of garbage can contaminate the water and food of the community, causing diarrhea in Dino. This garbage also caused the accumulation of standing water, allowing the dengue mosquito to develop and infect his sister. In addition, garbage has created a suitable environment for maleficent microorganisms, such as the bacteria that causes tuberculosis.

6 0
3 years ago
Which does a descriptive investigation include? Check all that apply.
blondinia [14]
Scientific question
Hypothesis
Conclusion
Observations
4 0
4 years ago
Other questions:
  • Which of the following statements best proves that the law of conservation of mass is obeyed during photosynthesis?
    15·2 answers
  • In the structure of glucose if the OH group on carbon atom 4 is above the plane of the ring then,it is alpha or beta or D glucos
    9·1 answer
  • I am very confused! Plz tell answer below! Plz hurry! Google is no help. :(
    14·2 answers
  • Which term describes this diagram?
    8·2 answers
  • Which of the following kingdoms contains prokaryotes?
    8·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Help Fast!!!!
    6·2 answers
  • 10 POINTS (and no its not 5 and I gave 10 its 10 and I gave 20)
    14·2 answers
  • One of the big ideas in science is that an experiment can be
    5·2 answers
  • The concept of evolution by way of natural selection is a central tenet in biology that has been tested in numerous ways by many
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!