1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Iteru [2.4K]
3 years ago
8

Which best describes the current trend of earths warming?

Biology
1 answer:
kari74 [83]3 years ago
3 0
The Earth is warmer than in previous natural cycles.




Positive effects of warmer temperatures?


Great tans, more swimming, motivation to get outside and do something instead of playing video games.
You might be interested in
the increase to heart rate is a normal homeostatic response and allows for an adjustment of the body's set point during exercise
hodyreva [135]

Answer:

it increases oxygen levels and decrease carbon dioxide levels

3 0
3 years ago
. What causes a hurricane to form <br><br><br> will give brainliest to smartest answer
Archy [21]

Answer:

For one to form, there needs to be warm ocean water and moist, humid air in the region. When humid air is flowing upward at a zone of low pressure over warm ocean water, the water is released from the air as creating the clouds of the storm. As it rises, the air in a hurricane rotates.

Explanation:

In short pressure zones over warm ocean

8 0
2 years ago
Read 2 more answers
Two protein kinases, K1 and K2, function sequentially in an intracellular signaling pathway. If either kinase contains a mutatio
Korolek [52]

Answer:

The order must be K2→K1, since the permanently active K1 allele (K1a) is able to propagate the signal onward even when its upstream activator K2 is inactive (K2i). The reverse order would have resulted in a failure to signal (K1a→K2i), since the permanently active K1a kinase would be attempting to activate a dead K2i kinase.

Explanation:

  • You characterize a double mutant cell that contains K2 with type I mutation and K1 with type II mutation.
  • You observe that the response is seen even when no extracellular signal is provided.
  • In the normal pathway, i f K1 activat es K2, we expect t his combinat ion of two m utants to show no  response with or without ext racell ular signal. This is because no matt er how active K1 i s, it would be unable to  act ivate a mutant K2 that i s an activit y defi cient. If we reverse the order, K2 activating K1, the above  observati on is valid. Therefore, in the normal signaling pathway, K2 activates K1.
7 0
3 years ago
Do you think it could be ethical to hunt a species to extinction to meet the needs and wants human society
Luda [366]

Answer:

No

Explanation:

This species that we would be killing off is innocent and not volunteering for this.

8 0
3 years ago
Read 2 more answers
Where does the oxygen released during photosynthesis come from​
victus00 [196]

Answer:

Oxygen liberated during photosynthesis comes from the splitting or hydrolysis of water in the green plants. Cornelius van Niel experimentally proved for the first time that the oxygen liberated during photosynthesis comes from water and not from carbon dioxide.

3 0
2 years ago
Read 2 more answers
Other questions:
  • Which of these is an example of a population in a desert ecosystem?
    7·2 answers
  • Which group contains only organs in a human body
    6·1 answer
  • How does upwelling affect coastal fisheries?
    10·1 answer
  • Explain why it can be difficult to definitively diagnose a disease.
    9·1 answer
  • Which equation correctly shows the reactants and products of photosynthesis? A C6H12O6 + 6CO2 --&gt; 6O2 + 6H2O B C6H10O6 + 6O2
    12·1 answer
  • Water (H2O), carbon dioxide (CO2), and oxygen (O2) are all quite small molecules, yet they move across cell membranes differentl
    5·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Match each step of the scientific method with its description.
    11·1 answer
  • Is Rough ER found in plants and animals cells?​
    12·1 answer
  • In the space provided, identify each of the four major biomolecules and their primary functions in the human body.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!