1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rina8888 [55]
3 years ago
12

How does sun provide us with the energy we need to run our bodies?

Biology
2 answers:
dusya [7]3 years ago
6 0
Well, the high energy and heat found in the photons of sunlight allow plants to make their own food, sustaining them long enough to be eaten by us, or to be eaten by animals about to be eaten by us. Plus we get direct warmth from the sun. These things mean that the sun is what keeps all organisms alive in the first place.
klasskru [66]3 years ago
3 0

Answer:

The sun provides energy through light radiation. This helps plants by providing them with the energy to convert carbon dioxide into sugars, which is how they grow. The sun helps humans in a variety of ways, but most importantly by fueling plant growth, so we can eat the plants and the other animals that eat the plants.

Explanation:

hope this helps

You might be interested in
______ are compounds that produce H+ ions in solution.<br> A. Acids<br> B. Salts<br> C. Bases
Nitella [24]

The answer is A, acids.

5 0
3 years ago
Read 2 more answers
What arw the importance of the atmosphere for man​
natulia [17]
We would not be able to live without it! It sustains life as we know it!
7 0
3 years ago
Which of the following was a control variable in this experiment?
DIA [1.3K]

Answer:

<em><u>b</u></em>

Explanation:

<em><u>mark</u></em><em><u> </u></em><em><u>me</u></em><em><u> </u></em><em><u>as</u></em><em><u> </u></em><em><u>brainleist</u></em><em><u> </u></em><em><u>answer</u></em><em><u> </u></em>

7 0
3 years ago
What is the mixture of water and other molecules found inside the cell?
Furkat [3]
<span>Cytosol is the mixture of water and other molecules found inside the cell.</span>
3 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • What are the characteristics of continental tropical air m
    9·1 answer
  • Plants need both sulfur and phosphorus in order to grow and reproduce. How do plants obtain sulfur and phosphorus?
    9·2 answers
  • Darwin hypothesized that new species could appear gradually through small changes in an ancestral species. What experiment did h
    8·2 answers
  • A "Cuckold bee" is a common term to describe several different kleptoparasitic lineages in Apoidea.
    7·1 answer
  • What is the name of the fluid-filled bag of thin tissue that develops around the embryo soon after implantation? amniotic sac pl
    10·2 answers
  • What is genetic trespass?
    10·1 answer
  • Name 3 physiological processes of cell membrane?{3mks} plz help me guys
    11·1 answer
  • The partial displacement of a bone from its joint is known as
    6·1 answer
  • Help!!! How do you feel about the idea of using CRISPR and other genetic modification technologies on humans? Is this a good ide
    11·2 answers
  • All enzymes which catalyze the chemical reactions of a cell are
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!