1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
15

Rotenone is a poison commonly added to insecticides. insects exposed to rotenone will die because

Biology
1 answer:
solong [7]3 years ago
6 0
They no longer will be able to produce adequate amounts of ATP.
You might be interested in
Submerging a plant cell in distilled water (100% water) will result in
I am Lyosha [343]

Submerging a plant cell in distilled water (100% water) will result in turgid plant cell.

When the plant cell is placed in distilled water which is a hypotonic solution , it takes up water by osmosis and starts to swell. Because plant cell has the cell wall bursting is prevented. As a result, he plant cell is said to have become "turgid" (i.e. swollen and hard).


7 0
3 years ago
Which of the following body systems work together to supply nutrients are oxygen and remove waste
Rufina [12.5K]
Circulatory system;<span>The circulatory </span>system<span> circulates blood through the </span>body<span>, </span>supplies<span> cells with </span>oxygen<span> and </span>nutrients<span> and</span>removes waste<span> products. Organs: heart, arteries, veins. ... The respiratory </span>system supplies<span> blood with 
</span>oxygen<span> in the lungs and </span>removes<span> carbon dioxide.</span>
8 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Animals are made up of which type of cells?
Irina-Kira [14]

Animal cells are typical of the eukaryotic cell, so that's what they  are made out of hope it helps

Explanation:

4 0
3 years ago
Read 2 more answers
Carla has applied for a loan. Choose from the following conditions the one that makes it likely that she will get an unsecured l
Vedmedyk [2.9K]
I think the correct answer from the choices listed above is option B. The condition that  makes it likely that she will get an unsecured loan is that <span> she is ready to pay a huge amount in interest. </span><span> An unsecured loan is a type of loan where there is no property that can be used as collateral and something that will prove she is worthy of the loan.</span>
6 0
4 years ago
Read 2 more answers
Other questions:
  • How to gain teens trust for medical reasons?
    11·1 answer
  • A corn plant known to be heterozygous at three loci is testcrossed. The progeny phenotypes and numbers are as follows:+ + + 455a
    8·1 answer
  • A nurse is delivering 3 l/min oxygen to a patient via nasal cannula. what percentage of delivered oxygen is the patient receivin
    10·1 answer
  • Name 3 parts of a flower and describe what it does
    15·1 answer
  • What are the macromolecules DNA and RNA referred to as?
    8·1 answer
  • 8. What are the products of photosynthesis?
    5·2 answers
  • Which component of the type a behavior pattern best explains the connections between the type a profile and heart disease?
    14·1 answer
  • Science under modern classification systems, in what clade will you find birds?
    10·2 answers
  • 32 POINTS!!
    8·1 answer
  • Help me please!! <br> I’ll brainliest u if u get it right!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!