1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paladinen [302]
3 years ago
12

You volunteer for a sleep study and the researchers discover that your blood oxygen level drops many times during the night. It

is likely that you have A) sleep-onset insomnia. B)
Biology
2 answers:
lutik1710 [3]3 years ago
7 0

<u>Sleep apnea </u>leads to oxygen drop at night

Explanation:

Obstructive sleep apnea is a sleep disorder characterized by repeated stopping and starting of breathing while asleep. This happens due to excessive relaxation of throat muscles that hinder the normal breathing process resulting in decreased oxygen level in the blood (hypopnea)

In order to study the sleep pattern and the disturbances happening while asleep, a sleep study is done which can provide details like length and number of disruptions in the breathing process, oxygen levels, etc

During a sleep study, the oxygen level of the patient is monitored with a pulse oximeter attached to the patient’s toe, finger, and other parts.

Due to disturbed breathing patterns, while asleep, a person with OSA will receive a reduced amount of air during inhalation. This leads to reduced oxygen levels entering the lungs and decreased amount supplied to all parts of the body carried by blood. This decrease in oxygen in the blood to below about 88% leads to oxygen desaturation.  

A repeated and frequent drop of oxygen levels at night will lead to a more potentially dangerous condition called hypoxemia.

Ilia_Sergeevich [38]3 years ago
4 0

<u>Complete Question:</u>

You volunteer for a sleep study and the researchers discover that your blood oxygen level drops many times during the night. It is likely that you have

A) sleep-onset insomnia.

B) REM behavior disorder.

C) narcolepsy.

D) sleep apnea.

<u>Correct Option:</u>

It is likely that you have "sleep apnea".

Option: D

<u>Explanation:</u>

Sleep apnea is a disorder which is identified by frequent stoppage and breathing start while sleeping. This is due to extreme relaxation of the throat muscles that hinder the normal breathing mechanism leading to reduced blood oxygen levels (recognized as hypopnea).

Throughout a sleep study, the patient's oxygen level is tracked with a pulse oxymeter connected to the hand, finger as well as other parts of the patient. An individual with SA will get a decreased amount of air in inhalation due to irregular breathing patterns while asleep.

You might be interested in
THE INTERRELATIONSHIPS OF ORGANISMS PLAY A VITAL ROLE IN THE BALANCE OF ANY GIVEN ECOSYSTEM. WHICH EVENT MIGHT INCREASE THE CARR
stiks02 [169]

Answer:

<em>A season of extra rain</em>

Explanation:

A prarie can be described as a habitat which is abundant in grasses. Although some type of shrubs and flowering plants can also be found on this land, grass can be seen abundantly in such ecosystems.

If a season with extra rain occurs in the prarie habitat, then there will be a production of more grass on this land. As a result, the rabbits will have more food to feed on. Hence, a season of extra rain will increase the carrying capacity for the rabbits.

3 0
2 years ago
Read pages 213 - 215
lozanna [386]
Whatever you do do not click on that link
5 0
3 years ago
Read 2 more answers
The synthesis of sugar molecules through the process of photosynthesis requires energy absorbed from sunlight. Bearing this in m
Serga [27]

Answer:

endothermic reaction

Explanation:

This means it cannot occur without energy (from the Sun).

6 0
1 year ago
A male deer (stag) has long and heavy antlers while the female (doe) does not, Explain the purpose of this genetic variation and
Liono4ka [1.6K]

Antlers are generally only found on male deer in other species of deer. Females with higher-than-normal testosterone levels, on the other hand, can grow antlers.

<h3>Why Do Deer Grow Antlers?</h3>

Antlers are grown by male deer to lure female deer for mating. Females will be shown a display as the antlers are developing during mating season, with each male attempting to become the most dominating.

Deer utilize their antlers to protect themselves from predators and other deer. When deer attack each other, their antlers might lock together, forcing the deer to starve to death.

For more information regarding antlers, visit:

brainly.com/question/17295060

#SPJ1

8 0
2 years ago
How does the process of natural selection work?
Vedmedyk [2.9K]

Answer:

If I am correct it is when the weaker individuals or mutated individuals are killed of by other predators or by nature. Because they cannot survive this is natural selection because they are killed of by nature. Then if they are weak their species will go extinct, thus they are naturally selected to die and only the strong species remain.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Define the following term: <br> First order consumer:
    6·1 answer
  • Which movement of particles would be most affected by a disorder that causes damage to carrier proteins?
    6·2 answers
  • Which of the following is in the correct order of the three periods in prenatal development from conception to birth? Group of a
    9·1 answer
  • Which of these BEST describes the difference between a hypothesis and a theory?
    6·2 answers
  • True or false? Less than 0.1% of the energy in a food chain generally makes it from the sun to quaternary consumers?
    14·2 answers
  • Is flowering patterns independent or dependent
    9·1 answer
  • Which term refers to the fact that naturally occurs omg he universe
    6·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Opinion: is our current water use sustainable? Why or why not?
    15·1 answer
  • What is the desired temperature for incubation?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!