1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivahew [28]
3 years ago
12

Volume is defined as the amount of mass that an object has? True or false

Biology
1 answer:
maria [59]3 years ago
3 0

Answer:

False

Explanation:

Mass and volume are two different quantities. In fact:

- Mass is a scalar quantity representing the "amount of matter" contained in a certain substance. It is measured in kilograms (kg), which is one of the 7 fundamental SI units.

- Volume is a scalar quantity representing the amount of "three-dimensional space" occupied by an object or a substance. It is measured in cubic meters (m^3).

Therefore, mass and volume are two different quantities. They are related through another quantity called density, given by:

d=\frac{m}{V}

where

m is the mass

V is the volume

So the density of a substance represents the amount of mass contained in a certain volume of the substance.

You might be interested in
Does increasing pressure, decrease or increase water potential?​
LUCKY_DIMON [66]

Answer:

the addition of solutes lowers the potential, while an increase in pressure increases the potential.

Explanation:

7 0
3 years ago
Why is breaking and rearranging bonds in the process of photosynthesis and cellular respiration important? WILL GIVE BRAINLIEST
____ [38]

Answer:

Photosynthesis

All organisms in the plant kingdom are autotrophs/producers and therefore carry out photosynthesis.  Photosynthesis occurs in the chloroplast (figure 1) of plant cells which are concentrated predominantly in the leaves.  The chloroplasts contain the green pigment chlorophyll, giving leaves their green color, and is responsible for capturing light energy to power photosynthesis.

Picture

Figure 1

All living things need a few basic things to survive, we learned these things as the four basic needs of living things.  Plants are no exception to this and require space, gases, food, and water like all other living organisms.

The two basic needs, water and gas are especially important for a plant to carry out photosynthesis. The water and gas makeup two of the three reactants of photosynthesis. The needed water (H2O) is absorbed from underground into the roots of the plant and is then transported to each cell by the vascular tissue xylem.

Picture

Figure 2 https://upload.wikimedia.org/wikipedia/commons/d/db/ Photosynthesis.gif

Plants cannot carry out photosynthesis without carbon dioxide (CO2), the gas animals exhale. Plants take in CO2 and release O2 (the opposite of animals) by the process of transpiration (respiration in animals).  

Although plants do not have lungs or lung-like structures, they do have small pores on the underside of their leaves that regulate transpiration.  These pores are called stoma or stomata and allow CO2 and O2 to enter and exit the plant leaves.  Each stoma is surrounded by two guard cells that open and close the stoma.  Stomata remain open when the plant is in need of CO2, during photosynthesis, and closed during times of photosynthetic inactivity.  You will be conducting a lab during which you will test when stomata tend to be open vs when they tend to be closed.

In addition to CO2 and H2O, plants must also have sunlight or light energy.  As mentioned above, the light energy absorbed by the chlorophyll powers the process of photosynthesis. Sunlight is responsible for breaking the molecular bonds of the CO2 and H2O and then rearranging the atoms into the products of photosynthesis, glucose (C6H12O6) and oxygen (O2). Through photosynthesis, light energy is converted into stored energy, the glucose (food).

To summarize: Energy from the sun is converted into stored chemical energy or food called glucose in the plant cell by the process of photosynthesis. The green pigment- chlorophyll- is located in the chloroplast and captures the sunlight. The energy from the sun is then used to change the carbon dioxide and water into the sugar glucose and oxygen. Glucose is a sugar that is stored energy for later use.

Explanation:

5 0
2 years ago
Read 2 more answers
_____ is one of the most serious long-term side effects of severe calorie restriction.
Mashutka [201]
Osteoporosis <span>is one of the most serious long-term side effects of severe calorie restriction.</span>
3 0
3 years ago
Why is abortion important?
Ksenya-84 [330]
It is important because some people might not be able to take care of the child and why would you make your own child’s life harder or they could be SA so it’s important to let people have a choice
5 0
2 years ago
Evergreen coniferous tree with red berries
N76 [4]
How is his a question???
5 0
3 years ago
Other questions:
  • According to morrie how are we different from plants and animals
    14·1 answer
  • What cover the nucleus of a cell
    13·2 answers
  • What are some natural resources that are common resources?
    7·1 answer
  • What are two social factors that affect population growth?
    12·1 answer
  • What does it mean when it says that aerobic respiration occurs in the cytoplasm “TO” the mitochondria???
    10·1 answer
  • What is a neap tide? What causes a neap tide?
    6·1 answer
  • The difference between a haploid and a diploid cell:
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Define and describe the five main types of evidence for evolution
    9·1 answer
  • TRY IT Analyze Data
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!