The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
The reason why nuclear fusion is currently not used as an energy source on Earth is mainly because we're still building the required technology which would enable us to use and have nuclear fusion and harness its power.
The main difference between vascular and nonvascular plants is that a vascular plant has vascular vessels to carry water and food to all the different parts of the plant.
Answer:
The peppered moths population declined becuase they could not blend in as well, until there was a gene mutation that favorably changed them all black becuase they could blend in when they were black.
Explanation:
i just had this question on edgunuity
