What is the process in which cells obtain energy without using oxygen?

1 answer:

6 0

Fermentation is the process that releases energy without using oxygen . In cellular respiration, anaerobic fermentation contrasts with aerobic cell respiration. Both processes convert glucose from food into adenosine triphosphate for energy for cells.

You might be interested in

Looking at the chemical reaction provided here, propose a different method that could be used to measure amylase activity: Starc

Anna007 [38]

Answer:

Starch + H2O = maltose

This reaction gives the Starch and H2O as the reactants and Maltose as the product.

Amylase is an enzyme which helps in the digestion of Starch molecules and its activity can however be measured through careful monitoring of the disappearance of amylase substrate which is in this case, starch.

3 0

3 years ago

If a cat normally has 38 chromosomes in its somatic (body) cells, how many chromosomes will be in its gametes? a. 76 b. none of

Keith_Richards [23]

Each gamete has half the number of chromosomes of the somatic cell. Hence, cats' gametes will have <u>19 chromosomes.</u> Option C.

<h3>What are the type of cells in the organism?</h3>

The types of cells in the organism are somatic and germ cells.

Both the somatic and germ cells go through mitosis producing two daughter cells with the<u> same </u><u>genetic dotation</u>.

Somatic cells are any cell in the body except sperm and egg cells. They are diploid, meaning they contain two chromosome sets, each one inherited from each parent.

Germ cells are diploid reproductive cells. They suffer mitosis to form more sexual cells, and a few suffer meiosis to produce haploid gametes. Each germ cell produces 4 haploid gametes.

Each gamete has half the number of chromosomes of the somatic cell. Hence, cats' gametes will have <u>19 chromosomes.</u> Option C.

You can learn more about gametes at

brainly.com/question/2569962

#SPJ1

5 0

2 years ago

In the early development of a zygote the number of cells increasein size in the process of

faust18 [17]

This process is mitosis. mitotic cell division is how they grow.

6 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Most abundant gas in the atmosphere;plants absorb it from bacteria in the soil

FromTheMoon [43]

Plant absorb nitrogen gas from bacteria in the soil

3 0

3 years ago

Read 2 more answers