1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
guajiro [1.7K]
3 years ago
13

Darwin hypothesized that new species could appear gradually through small changes in an ancestral species. Which observation tha

t he made about finches most supports that hypothesis?
A. The finches all ate the same materials as the mainland population.
B. The finches were all relatively small compared to the mainland population.
C. The finches all appeared to be related but differed from the mainland population. D. The finches were identical to the mainland population.
Biology
2 answers:
Crazy boy [7]3 years ago
8 0
He is correct the answer would be C. The finches all appeared to be related but differed from the mainland population.
raketka [301]3 years ago
7 0

Answer: C. The finches all appeared to be related but different from the mainland population.

Darwin compared the finches of Galapagoes island and Mainland. He hypothesized the fact that one species might have migrated to the Galapagoes island from mainland and undergone with modifications in different ends from the ancestor species. He proposed that around 13 species of finches evolved from a single ancestor species. This process in which one species giving rise to multiple species which have different corresponding niches is called as adaptive radiation. These finches were adapted according to their different diets: seeds, flowers, insects and leaves. The ancestor finches were ground-dwelling and insect eating. The expense of speciation  in the Galapagoes island resulted in 14 species of finches which includes three species of ground-dwelling seed eaters, three others living on cactus and eating seeds, one living in trees and eating seeds, and 7 species of tree-dwelling insect-eaters. Therefore, the finches all appeared to be related but different from the mainland population.  




You might be interested in
HELP ASAP !!!!!!!!!!
Jobisdone [24]

Answer:

the answer would be the first one which is sexual reproduction

8 0
3 years ago
Help this is due tomorrow
Zinaida [17]

Answer:

chicken wit a bagel

Explanation:

you see the chicken got a bagel

8 0
3 years ago
Read 2 more answers
What process can account for a normal xy male producing a sperm carrying two y chromosomes?
VikaD [51]

The answer is aneuploidy. This is the result of a malfunction in the process of meiosis that produces gametes, in the male.  The is caused by a failure in non-disjunction hence an extra Y chromosome occurs in one of the formed gamete cells during anaphase II.






7 0
3 years ago
What is the vaccine for tuberculosis???​
alukav5142 [94]
Tuberculosis vaccines are vaccinations intended for the prevention of tuberculosis. Immunotherapy as a defence against TB was first proposed in 1890 by Robert Koch. Today, the only effective tuberculosis vaccine in common use is bacilli Calmette-Guérin, first used on humans in 1921.
5 0
3 years ago
Which part of a green plant shows the greatest decrease in chloroplasts in the fall of the year?
Trava [24]

Answer:

The Leaves

Explanation:

5 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • When the temperature of the environment changes, what dose the body temperature of a reptile do
    7·1 answer
  • In the cells of some organisms, mitosis occurs without cytoki-nesis. this will result in
    7·1 answer
  • Pea plants heterozygous for flower position and stem length (AaTt) are allowed to self-pollinate, and 400 of the resulting seeds
    7·1 answer
  • Goblet cell hyperplasia is associated with asthma. based on their function, what is the likely outcome of an overabundance of go
    5·1 answer
  • gray seed color in peas is dominant to white. assume that mendel conducted a series of experiments where plants with gray seeds
    15·1 answer
  • Michael,a 43-year-old was in a serious car accident. He has a rigid and tender left hypochondriac region. His blood pressure is
    7·1 answer
  • Which of these describes a quantitative observation?
    8·2 answers
  • In which process does some rainwater soak into the ground and replenish aquifers?
    15·2 answers
  • ____ produce their effect by preventing an enzyme from breaking down serotonin and norepinephrine, thereby _____ the availabilit
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!