1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol13
3 years ago
11

When the pH decreases from 6 to 3, the hydrogen ion, H+, increases by what?

Chemistry
1 answer:
Irina-Kira [14]3 years ago
3 0

pH decreases as the hydrogen ion concentration increases.

<u>Explanation:</u>

When there is a decrease in pH, that is pH decreases from 6 to 3 then the acidity increases.

That is the pH is between 1 to 7 then it is acidic

When the pH is 7 then it is neutral

When the pH is between  7 to 14 then it is basic

As the H⁺ ion concentration increases, then the pH value decreases, here pH decreases from 6 to 3.

So the concentration of Hydrogen ion increases, pH decreases.

You might be interested in
How many grams of Fe3O4 are required to react completely with 300 grams of H2?
vekshin1

Answer:

2023.04 g

Explanation:

Magnetite reacts with hydrogen to produce Iron metal and steam. Steam instead of water is produced as the reaction occurs at temperatures above the boiling point of water.

Fe₃O₄ + 4 H₂ → 3 Fe +4 H₂O

From the equation, 1 mole of Fe₃O₄ reacts with 4 moles of H₂.

69.76 grams of H₂ has the following number of moles.

Number of moles= mass/RAM

=69.76/2

=34.88 moles.

The reaction ratio of Fe₃O₄ to H₂ is 1:4

Thus number of moles of magnetite= (1×34.88)/4

=8.72 moles.

Mass= moles × molecular weight

=8.72 moles × (56×3+16×4)

=2023.04 grams

8 0
3 years ago
For years, surgeons have had great success using _____.
FrozenT [24]
C the artifical heart
6 0
3 years ago
Read 2 more answers
Which of these safety features aims to keep nuclear radiation contained
rewona [7]

The safety feature aimed at keeping nuclear radiation contained is steel-reinforced concrete.

<h3>What is nuclear power plant?</h3>

A nuclear power plant is a building with reactors that contain controlled nuclear reactions to produce energy.

Nuclear power plants are able to generate warm water by using atomic properties of matter  (i.e.,m the process of nuclear fission), which is in turn converted into steam to move turbines.

The walls of nuclear power reactors are composed of steel-reinforced concrete in order to avoid radiation release.

In conclusion, the safety standard property that maintains nuclear radiation contained is steel-reinforced concrete.

Learn more about nuclear power plants here:

brainly.com/question/24295936

#SPJ1

4 0
2 years ago
How many cyanides are needed to bond with Strontium?
Gala2k [10]

Answer:

3

Explanation:

6 0
3 years ago
PLEASE HELP ME PLEASE PLEASE PLEASE
TEA [102]

Answer:

sorry

Explanation:

3 0
3 years ago
Other questions:
  • Can you place the following elements in order of decreasing atomic size: selenium, chlorine, fluorine, rubidium, calcium, and su
    14·2 answers
  • To produce energy, nuclear power plants use a process called...
    11·2 answers
  • Helppp mee plz guysss
    11·2 answers
  • 35 points Hi i have 5 mins to turn this in please help...thank you
    15·2 answers
  • Which is not a part of the Nervous System?
    9·1 answer
  • Help me please!
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Only 14 one pleaseeee
    6·1 answer
  • 2. What mass of water absorbs 6700 J of heat to raise the temperature from 283K to 318K?​
    15·1 answer
  • How many moles of oxygen are necessary to generate 28 moles of water, according to the following equation: 2H2+O2→2H2O
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!