1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vitek1552 [10]
4 years ago
11

Genes are portions of DNA and they have the ability to

Biology
2 answers:
baherus [9]4 years ago
7 0
They are also determined that it’s possible for cells to maintain the regions of RNA and cuts out short pieces that can serve in a regulatory role
pychu [463]4 years ago
7 0
They are determined that it’s possiblefor cells to maintain
You might be interested in
A commercial advertising a diet pill says it is scientifically proven to help you lose weight. It is recommended by a doctor who
lisov135 [29]

Answer:

No it hasn't been recommended by a doctor.

Explanation:

This is considered pseudoscience because there is no proof that it has been scientifically proven.

6 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
What role do histones play in a cell?
Sergeeva-Olga [200]
In biology, histones are highly alkaline proteins found in eukaryotic cell nuclei that package and order the DNA into structural units called nucleosomes. They are the chief protein components<span> of </span>chromatin<span>, acting as spools around which DNA winds, and playing a role in </span>gene regulation<span>.</span>
7 0
3 years ago
Many cells make and use an enzyme, called catalase, to facilitate the decomposition of hydrogen peroxide (H2O2). The products of
Len [333]

Answer:

A. It decreases the activation energy needed to start the reaction

Explanation:

Organic catalyst which speed up the rate of organic chemical reaction is living cells are called enzymes.They have specific reaction site called active sites.This must be in prefect shape with the substrate for the organic chemical reaction to take place

When this occurs the minimum amount of  energy of  reaction to  activate or stimulate  the the atoms and molecules of the substrate to undergo chemical reaction is  lowered.This energy of reaction is celled activation energy.

Catalase thought its active sites lowers the activation energy so that the molecules of H2O2 could break down to C02 and H2 faster,thereby reducing the time for theses product to form.The is the general roles of enzyme.To increase the rate of chemical reaction,by reducing the activation  energy.

8 0
4 years ago
The atoms found in living tissues all have complete outer electron shells and are therefore quite stable on their own.
nataly862011 [7]
What is your question?

3 0
4 years ago
Other questions:
  • Ringing of the ears after exposure to loud music is most likely to be caused by damage to
    12·1 answer
  • Farmer Brown believes that increasingly large doses of antibiotics will produce increasingly large beef cattle. What is the CORR
    14·1 answer
  • Assume an animal lives in a mudflat that experiences low oxygen and high carbon dioxide levels twice a day during low tides. how
    8·1 answer
  • What is apple plus a banana it's really hard only big brain get it
    6·1 answer
  • The _____ is the part of the peripheral nervous system that directs the activity of glands, organs, and smooth muscles.
    5·1 answer
  • Why does the American southwest have deserts even though the rest of the country has temperate climates? A. The southwest receiv
    6·1 answer
  • In the large intestine material is stored how many<br>hours prior to elimination?​
    12·2 answers
  • The maps below represent the same area of the Amazon rainforest over an 8-year period as humans moved into the rainforest. Fores
    15·1 answer
  • 1. Why are kids afraid of ghosts? 2. Should I feed the raccoons that visit my trash can? 3. How does mouse color affect mouse su
    11·1 answer
  • Which of theses processes makes it possible for cells to take in water?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!