1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mixer [17]
3 years ago
7

Personal Finance

Biology
1 answer:
geniusboy [140]3 years ago
6 0

Answer:

<em>The correct option is A) green belts</em>

Explanation:

Environmental stressor can be described as any thing in the environment which will have the ability to cause stress.

A green belt can be described as a vast land around a city in which building anything is restricted. It is a good and positive approach for planning as it limits urban sprawling. Hence, option A is correct.

Other options, like earthquakes, toxic substances and high noise levels are environmental stressors.

You might be interested in
An enzyme-catalyzed reaction was run at five different temperatures (trials 1-5). The results are shown in the data table above.
arlik [135]
It's the last one it's featured causing it to produce nothing at 70°c
7 0
3 years ago
Read 2 more answers
What is the content of the<br>injected material (vaccine)?​
krok68 [10]
Aluminium, an adjuvant.
MF59 (squalene oil), an adjuvant.
Thiomersal, also called Thimerosal.
8 0
3 years ago
Which member of the solar system has a diameter of 3.48 x 103 kilometers
shtirl [24]

Answer:

j

Explanation:

7 0
3 years ago
A student want to view live organisms less than 1 millimeters in size, which are found in a water sample collected from a stream
STALIN [3.7K]

Answer:

A

Explanation:

6 0
3 years ago
Read 2 more answers
Define the term excretion.
Luba_88 [7]

Answer:

Excretion is a process in which metabolic waste is eliminated from an organism. In vertebrates this is primarily carried out by the lungs, kidneys, and skin.

Carbon dioxide

The liver regulates most chemical levels in the blood and excretes a product called bile. This helps carry away waste products from the liver. All the blood leaving the stomach and intestines passes through the liver. The liver processes this blood and breaks down, balances, and creates the nutrients and also metabolizes drugs into forms that are easier to use for the rest of the body or that are nontoxic.

p/s: pls vote if u find it's useful :3 thank youuu

3 0
3 years ago
Other questions:
  • In a species of insect, wing length is determined by a single gene, for which there are only two alleles. in a population of 150
    5·2 answers
  • Type of energy source that's will eventually be used up
    7·1 answer
  • Insects often act as pollinators for plants. In turn plants provide these insects with food. What kind of a relationship exists
    14·2 answers
  • Look carefully at the model. During a drought, there is less water available for the plants. There is less runoff and less infil
    15·2 answers
  • What would you expect to find at the surface of the Atlantic Ocean​
    12·1 answer
  • Why is the cell theory only a theory and not a law?
    13·1 answer
  • How does evolution involed?
    11·1 answer
  • Why does low air pressure usually indicate stormy weather?
    13·1 answer
  • Which tool did Maurice Wilkins use when studying DNA?
    9·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!