1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mixer [17]
3 years ago
7

Personal Finance

Biology
1 answer:
geniusboy [140]3 years ago
6 0

Answer:

<em>The correct option is A) green belts</em>

Explanation:

Environmental stressor can be described as any thing in the environment which will have the ability to cause stress.

A green belt can be described as a vast land around a city in which building anything is restricted. It is a good and positive approach for planning as it limits urban sprawling. Hence, option A is correct.

Other options, like earthquakes, toxic substances and high noise levels are environmental stressors.

You might be interested in
Which statement is true about nitrogen and oxygen?
kkurt [141]

B, They are both made of protons, neurons, and electrons

Explanation:

Nitrogen and oxygen are both gases at normal warmth and pressure. They are more both elements. They both dissolve at a really cold temperature.

They're the principal components of Earth's atmosphere.

They're both diatomic gases.

They're both nonmetals.

They're both light elements.

Both of them are involved in the CNO cycle.

7 0
3 years ago
Read 2 more answers
C.s. is a 49-year-old male who goes to the health care provider because he is experiencing heartburn more frequently and it is k
Svetllana [295]
Gerd can cause damage to the throat and airways from gastric contents and can cause asmatic symptoms. It is also worth noting that gerd symptoms tend to worsen at night from laying flat.
8 0
3 years ago
Which of these human activities is most likely to cause an increase in the number of asthma sufferers?
allochka39001 [22]
In my honest opinion, i would think it would be the C the burning of plastic in open burn barrels I am only saying that because my asthma acts up when there is fire or smoke and I think that's the best option.
4 0
4 years ago
Read 2 more answers
Help! Help! Easiest Help that can be given! Please answer all the questions!
finlep [7]
As in terms of the first one. ants are exerted by less gravity then us humans and this hesbily tskes part in hiw much things weigh to us the more mass the more gravity. hope this helped
6 0
4 years ago
You, suddenly grown very small because you drank too much TinyMe, are standing between
N76 [4]

Answer:

I would say it's pectin secondary cell, but don't trust my word

7 0
3 years ago
Other questions:
  • Concept review: factors influencing climate can you determine whether these factors have a warming or cooling effect on earth's
    14·1 answer
  • The movement of organisms into an area is called
    6·1 answer
  • A balance between gravity pulling atoms toward the center and gas pressure pushing heat and light away from the center is called
    13·1 answer
  • What happens when dilute acid is dropped onto carbonates?
    13·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • One of the most common types of bacteria-related diarrhea in the united states, resulting primarily from the ingestion of contam
    15·1 answer
  • Net primary production is: the net energy received by plants after subtracting what is turned into plant material. only the ener
    11·1 answer
  • Which features of the sun are typical of stars
    10·2 answers
  • Explain how artificial selection can upset the process of natural selection.
    14·1 answer
  • members of the _____ movement would be very concerned about the unequal exposure of members of a certain race to pollution.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!