1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tema [17]
3 years ago
5

Which question can be Answered by an experiement

Biology
2 answers:
Kazeer [188]3 years ago
6 0

They forgot the answers

A. Do sugar substitutes cause cancer

B. Did an ice age kill off the mastodons

C. What caused the extinction of the dinosaurs

D. Are all people susceptible to the hunta virus


I say both A and D can be answered with and experiment.

Nastasia [14]3 years ago
4 0
This question can be answered
You might be interested in
Starving children may die from eating many lychee fruit but children who have eaten during the day or not affected. Explain why.
stira [4]

Answer:

Fruits should never be eaten when one hasn't had a proper meal.

7 0
3 years ago
Read 2 more answers
Floridian starch is characteristic energy storage material of which algae
kvv77 [185]
Floridian<span> starch is characteristic </span>storage material<span> made from Rhodophyta, or in other words, red Algae
Hope this Helps :D </span>
7 0
3 years ago
Read 2 more answers
16. Which excretory organ helps to control the water potential of the tissue
Yanka [14]

The answer is a Kidneys

5 0
3 years ago
Read 2 more answers
A lab technician is preparing agar medium. The medium requires 21 grams (g) of
docker41 [41]

Answer:

21.81grams

Explanation:

According to the question, an agar medium requires the following ingredients: 21 grams (g) of

agar, 500 mg of dextrose, 3 dg of sodium, and 1 cg of potassium per 1,000 milliliters (mL) of distilled water.

Hence, the dry ingredient contain 21grams (g) of agar, 500milligrams (mg) of dextrose, 3decigrams (dg) of Sodium, and 1centigrams (cg) of pottasium.

We need to convert all units (not in grams (g)) to grams.

1grams = 1000milligrams

500 milligrams = 500/1000

= 0.500grams.

1grams = 10decigrams

3decigrams = 3/10

= 0.3grams

1grams = 100centigrams

1centigrams = 1/100

= 0.01 grams

Therefore, we have 21g, 0.500g, 0.3g, and 0.01g

The total dry weight of the ingredients will be:

21 + 0.500 + 0.3 + 0.01

= 21.81grams

3 0
3 years ago
Dan has noticed that when he adds fertilizer to his garden soil his strawberry plants seem to grow better. Dan wonders if it is
madreJ [45]

The correct answer is - the variable.

With the experiment, in the way that Dan had decided to perform it, the fertilizer is the variable, as in one of the parts with strawberries he uses fertilizer, while in the other part he doesn't uses fertilizer.

While this kind of experiment may give Dan some answers, and he might notice differences, still he would have to be more detailed in the experiment to see for sure if the fertilizer is the thing that makes some of the strawberries grow better than the others.

Dan should also put all of the strawberries at places that would receive the same amount of light, experience the same weather conditions, receive the same amount of water, and to be planted in a soil of the same quality. Only like this, after putting the fertilizer, Dan can now if it makes any changes or not.

4 0
2 years ago
Other questions:
  • What are the six steps of water erosion
    9·1 answer
  • What is the boiling point of pure tap water with three tablespoons of salt?
    14·1 answer
  • What is the most important factors that determine the rate of weathering?
    10·1 answer
  • What is an ecosystem?
    8·1 answer
  • Cichlids are bony fish that are commonly found in the freshwater lakes of Africa, like Lake Victoria. There are more than 2000 r
    5·2 answers
  • Which are examples of harmful mutations? Check all that apply. one that causes a person to have a light patch of hair color one
    8·2 answers
  • A scientist observed a fungus and recorded what she saw:
    8·1 answer
  • Noravirus can be prevent
    14·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What are some Characteristics of a ladybug before metamorphosis
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!