It seems that you have missed the necessary options for us to answer this question, so I had to look for it. Anyway, here is the answer. Samaira needs to rent some tents for an outdoor family reunion in July, so the type <span>of tent for Samaira to rent so that her family members are protected from the heat of the sun is SMOOTH and WHITE TENT. Hope this answer helps.</span>
If you have just eaten, your body will secrete insulin. Insulin is the hormone that allows glucose to enter cells. That way they will have the proper energy for their normal functions.
If you have not eaten for a while, your body is running out of glucose to feed the cells so it needs to secrete another hormone called glucagon. This hormone is the complete opposite of insulin because it breaks down glycogen, proteins and fats into glucose.
Answer:
The answer is C. Species diversity or B. Ecosystem diversity everyone thinks it either those 2 nobody really knows.
Answer:
B.) They have the same color and texture.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
