1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
matrenka [14]
3 years ago
8

What connects neurons?

Biology
2 answers:
BabaBlast [244]3 years ago
6 0
It's D.Synaptic gaps
dimulka [17.4K]3 years ago
5 0
This pulse travels rapidly along the cell's axon, and is transferred across a specialized connection known as a synapse to a neighbouring neuron, which receives it through its feathery dendrites. So I would say axon
You might be interested in
What characteristics of DNA results in cell differentiation in developing embryos?
Elina [12.6K]

Hi!


The correct option is B. Which genes are active.


Embryonic differentiation is a developmental process by which embryonic cells give rise to specialized cells and a diverse range of tissue structures. All of this unique cells essentially rise from a type of cells that are known as pluripotent cells.

But how do these pluripotent embryonic stem cells know which cells to differentiate into? This is where genes come into play. The cell has an inherent signalling ability that determines which gene is to be active and expressed. These specifically activated genes then translate into proteins for which it is specific, giving each cell, tissue and organ its particular identity.


Hope this helps!

5 0
3 years ago
What is the monomer of a proteins?
Genrish500 [490]
Amino acids is the monomer of protein

7 0
3 years ago
Read 2 more answers
DNA stands for which of the following?
Andre45 [30]

Deoxyribonucleic acid.

5 0
2 years ago
Read 2 more answers
What biome is most of the small islands
xenn [34]
Mediterranean I think
4 0
3 years ago
During photosynthesis, the energy used to pump protons comes from ___________, whereas in cellular respiration it comes from ___
Annette [7]

During photosynthesis, the energy used to pump protons comes from ______light_____, whereas in cellular respiration it comes from ______NADH/FADH₂_______.

<h3>What are the steps in photosynthesis?</h3>
  1. The first step in photosynthesis is the absorption of light by chlorophyll bound to chloroplast thylakoid proteins. The absorbed light energy is used to remove electrons from electron donors such as water to form oxygen.
  2. The electrons are then transferred to the primary electron acceptor, quinine (Q.). Electrons are further transferred from the primary electron acceptor to the final electron acceptor (usually NADP⁺).
  3. Proton transfer from the thylakoid lumen to the stroma via the F₀F₁ complex generates ATP from ADP and Pi.
  4. The NADP and ATP produced in steps 2 and 3 provide the energy, and the electrons power the process of reducing the carbon to a six-carbon sugar molecule.

The first three steps of photosynthesis, are directly dependent on light energy and are thus, called light reactions, while the reactions in the last step are independent of light and thus are termed dark reactions.

To know more about photosynthesis visit:

brainly.com/question/1388366

#SPJ4

5 0
1 year ago
Other questions:
  • What are the 2 differences between Plant and animal cells?
    7·2 answers
  • 3) Once cells with nuclei developed, organisms were able to become more complex, which allowed them to adapt to the conditions i
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • According to Nutton, we are unable to identify any diseases familiar to us today because because we are hampered by the great di
    15·1 answer
  • Holds the genetic information in the DNA and controls all cell activities​
    12·1 answer
  • describe the different roles in an ecosystem by what an organism eats and its relationship to the other organism​
    10·1 answer
  • Right answers only no links more points!!
    8·2 answers
  • The chemical equation shown represents photosynthesis.
    13·2 answers
  • 1. Name six (6) physical or behavioral characteristics of the cane or bufo toad.
    8·1 answer
  • Question 12 of 15<br> A__ is a device that allows a car to use hydrogen gas to operate.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!