1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blagie [28]
4 years ago
11

Describe three ways that a wildfire affects a forest ecosystem _______________

Biology
1 answer:
Anon25 [30]4 years ago
8 0
The smoke in the air can get in your lungs and that is bad, it kills our trees that provide oxygen and if you get caught in a wild fire it can kill you and other animals. Hope this helped!!!
You might be interested in
2. Why do Earth's tectonic plates move?
Lena [83]

Answer:

D. They float on convection currents in the mantle.

Explanation:

4 0
3 years ago
Help with these five questions anyone it would be very helpful?
uranmaximum [27]
Admission to practice law<span>. ... In English, admission is also called a </span>law license<span>. Basic requirements vary from country to country, as described below. In some jurisdictions, after admission the lawyer needs to maintain a current practicing certificate to be permitted to offer services to the public.</span><span />
6 0
3 years ago
The small units that make up the macromolecule DNA are called
Leokris [45]
Nucleotides. They are the building blocks of DNA.
7 0
3 years ago
What is a possible benefit of startling plants in the rain forest
saveliy_v [14]
Rain forest plants all work together to provide food and shelter for rain forest animals, as well as to convert carbon dioxide to oxygen. Ground-level competition for light and food has resulted in some unusual plant evolution.
7 0
2 years ago
Read 2 more answers
A monocular cue for depth that cannot be used by artists in their paintings is _____.
Alex777 [14]
The answer is Accommodation
7 0
3 years ago
Other questions:
  • When there is a well-established segment of heterochromatin on an interphase chromosome, there is usually a special barrier sequ
    15·1 answer
  • In which case will the object move due to an unbalanced force?
    7·1 answer
  • In heredity, is “Cc” dominant or recessive?
    14·2 answers
  • osh is assigned a project in class to make a design a strand of m-RNA from DNA.The DNA code that he has been assigned is CGG TCG
    11·2 answers
  • If a DNA sequence is altered from TAGCTGA to TAGTGA, what kind of mutation has occurred? View Available Hint(s) If a DNA sequenc
    10·1 answer
  • What is the purpose of transcription?
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • A cell begins to produce a new type of protein. This is most likely due to an alteration of the 1 point structure of the cell me
    15·1 answer
  • What domain is eubacteria found in?
    9·1 answer
  • hola se que todos ablan igles pero alguien que sepa español mi preguta es de carta de agradecimiento a una madrina de beca pero
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!