1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viva [34]
3 years ago
11

Susie wants to measure the mass of pebble she found at the park. Which tool would she use to do so?

Biology
1 answer:
Law Incorporation [45]3 years ago
5 0

You would use A.) Triple beam balance as it is the only option that measures mass.

B measures length, C and D measure volume.

You might be interested in
What are the 5 branches of arthropods? Draw the evolutionary cladogram.
dimaraw [331]
The five main characteristics are foot region, hard exoskeleton, bilateral symmetry, left and right limbs and a segmented body.
3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which characteristics do all bacteria and archaea have in common?
Alex Ar [27]

Answer:

c

Explanation:

6 0
3 years ago
Read 2 more answers
the theory that all of the continents were once a super-continent and that those continents split apart and have been moving awa
Lina20 [59]
The theory is the Continental drift, the super-continent is called the Pangaea.
5 0
3 years ago
why does the complexity of gene regulation mirror the complexity of the organism in which it is found?​
Nataliya [291]

Answer:

Organisms that are more complex, such as eukaryotes, have cells that are specialized for specific functions. Gene regulation needs to be more complex to produce these specialized cells for complex organisms. Please Mark Me Brainliest

Explanation:

7 0
3 years ago
Other questions:
  • Compare ralph's treatment of the littluns with jack's. in chapters 5 - 6
    8·1 answer
  • Identify 2 things that can cause mutations
    7·1 answer
  • Which term describes the process that involves reproduction of two different organisms resulting in two haploid cells, each with
    12·1 answer
  • Which organelle is responsible for manufacturing proteins? vacuoles lysosomes golgi apparatus ribosomes
    7·1 answer
  • The most effective way to reduce household waste would be to
    10·1 answer
  • What are the four functions of stems? (Put it in your own words.) no google
    14·1 answer
  • Which of the following should be a characteristic of a stable ecosystem?
    8·2 answers
  • Please help!! Quick
    12·1 answer
  • Help ASAP!!!!!!! 10 points
    13·1 answer
  • type of advance medical directive does the AMA recommend? a) Euthanasia b) Living will c) Durable power of attorney O d) Undue-b
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!