1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wel
3 years ago
14

Some operons have both a positive and negative control mechanism built into the DNA sequence of the operon. That means both an a

ctivator protein and a repressor protein are present simultaneously. Consider a system that has both positive and repressible negative controls. a. Describe the four combinations of active or inactive regulatory proteins that could be present at any time in the cell.
Biology
1 answer:
ahrayia [7]3 years ago
7 0

Answer:

Following are the four combinations of active or inactive regulatory proteins that could be present anytime in the cell:

Active repressor , Active activator.

Active repressor, Inactive activator.

Inactive repressor, Active activator.

Inactive repressor, Inactive activator.

Explanation:

Use the attached diagram for

explanations on the four combinations of active or inactive regulatory proteins in cells.

You might be interested in
Cationic detergents are surface active agents, also known as ______, which damage bacteria by binding bacterial surface proteins
vfiekz [6]
Surfactants; cell membrane
8 0
3 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
If guanine replaces with cytosine in erd codon of gene 4, what will happen to the organism <br> ​
grandymaker [24]
Can cause mutations
6 0
3 years ago
The group that isn’t not manipulated by the researcher and is then compared to the experimental group is called what
ASHA 777 [7]
The Controlled group.
8 0
3 years ago
The hard outer covering of an animal is a(n) ___________.
RUDIKE [14]

Answer:

exoskeleton

Explanation:

An exoskeleton is the hard outer covering that supports and protects some animals without backbones.

Hope this helped!!!

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is responsible for transporting oxygen throughout the body
    9·1 answer
  • Select the correct answer.
    7·1 answer
  • The geological time scale is divided up and organized according to what life forms existed on earth.
    11·2 answers
  • What combines with a sugar and phosphate group to form a nucleotide
    15·1 answer
  • Which of the following are guidelines to follow for obtaining accurate observations? A. Taking careful measurements B. Using vag
    9·1 answer
  • Through _______ larger molecules are formed
    8·2 answers
  • Suppose you lean against a wall. You are pushing on the wall, but is the wall pushing back? How do
    11·2 answers
  • Which is true about organisms that survive longer?
    11·1 answer
  • The GO phase is for cells that do not
    13·1 answer
  • Please answer Help me !
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!