1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir2022 [97]
3 years ago
6

What disease is caused by misshaped red blood cells that prevent oxygen from properly reaching other parts of the body?

Biology
1 answer:
NikAS [45]3 years ago
8 0
One of the possible answers is sickle cell.

You might be interested in
Plzzzzzzz help.........
Oliga [24]

Answer:

The top right is Protist

The top left is Eubacteria

Explanation:

Researched off reliable websites gimme a brainliest?

8 0
2 years ago
Why do researchers believe that mammals evolved such large brains, such as that of hadrocodium?
tresset_1 [31]

Cause mammals are the only species that are well developed before birth unlike marsupial and monotremes

5 0
3 years ago
During pollination in seed plants, pollin grains
Andre45 [30]

Answer:

umm is this a staement or a question

Explanation:

3 0
3 years ago
A ______ is anything in the environment that affects the behavior of an organism.
Svetach [21]

Answer:

Heyaaa!!! Your answer for this question will be....

Explanation:

!!! <u><em>Stimulus aka (D)</em></u> !!!

<em>Lmk If You Have Any More Questions!</em>

<em />

<em>  </em><em>Have A Nice Day!!</em>

<u><em>~Pinky~</em></u>

7 0
3 years ago
Read 2 more answers
Which two are necessary for a functional ecosystem?
Art [367]

Answer:C and D

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • What is the number of this particle in a phosphorus atom?<br> Ap ex
    6·2 answers
  • How do cells combine and reproduce to create different combinations of DNA in babies?
    8·1 answer
  • The nurse is teaching a client, gravida 1 para 0, at 8 weeks gestation about expected weight gain in pregnancy. The client's pre
    9·1 answer
  • Many beverage companies are required to
    12·1 answer
  • Describe the key steps in the semiconservative replication of DNA.
    6·1 answer
  • During receiving of a food order, you notice a bag of rice with signs that the bag has been wet. What do you do?
    7·1 answer
  • AYO HELP MEEEEE VBJKEBADHK
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which hormone signals body cells to take in glucose
    11·2 answers
  • The survival of a species depends on its ability to adapt to changes in the environment. A species must be capable of surviving
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!