1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
12345 [234]
3 years ago
10

A new trait that allows a more efficient release of energy from food appears in a fly population. The trait proves beneficial to

survival and quickly spreads through the population. Which is the MOST likely origin of the new trait?
A. the mutation of a gene that results in an altered protein

B. the adaptation of a new genes to existing genes in the digestive system

C. the combination of recessive genes in each generation

D. the replication of a gene that produces an increase in RNA

Please help! Will award brainliest (:
Biology
1 answer:
pickupchik [31]3 years ago
6 0

The answer is A. The mutation of the gene was a beneficial one.  It happened in a few individuals and increased their survival rate. The mutation was also inheritable hence was passed down generations. The new gene probably altered a protein involved in metabolism. There are two other types of mutations; deleterious and neutral.






You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
How does the cell membrane in the drawing above help to maintain the health of this cell?
Ivanshal [37]

Answer: the answer is B

Explanation:

3 0
3 years ago
Can u help me with this please
sesenic [268]
This is only explanation. What are the questions for it?
7 0
3 years ago
If a DNA strand has a nucleotide sequence of CATGAGTTA, what will the mRNA strand be after transcription?
prohojiy [21]

Answer:

leave the nucleus, goe to the cytoplasm,bind to a ribosome to be read

7 0
2 years ago
Identify the highlighted artery. Identify the highlighted artery. right coronary marginal circumflex left coronary
vekshin1

Highlighted artery is right coronary.

<h3>What is artery?</h3>
  • The blood channels that carry oxygen-rich blood from the heart to the body's tissues are called arteries.
  • Each artery consists of three layers and is a muscular tube bordered by smooth tissue.
  • The endothelium, a smooth tissue, lines the intima, the inner layer.
  • Blood is transported from your heart through arteries.
  • All body parts have arteries, with the exception of the hair, nails, epidermis, cartilages, and cornea.
  • In the limbs, they run along the flexor surface, where they are less vulnerable to injury, and the larger trunks typically occupy the most protected positions.
  • A conduit that carries blood from the heart to the body's extremities is called an artery.
  • Every artery, with the exception of the pulmonary artery, carries oxygenated blood.
  • The ascending aorta, aortic arch, thoracic aorta, and abdominal aorta are the four divisions of the aorta, which is the biggest artery in the body.

Learn more about artery here:

brainly.com/question/14015132

#SPJ1

6 0
1 year ago
Other questions:
  • 1) the beauru of land management manages over ___ acres of land in the united states.
    14·2 answers
  • How are carbohydrate polymers formed? by hydrolysis by dehydration synthesis by replication by transcription
    13·2 answers
  • What Is not true of animals?
    8·2 answers
  • Which characteristist is found in the whale but not in its food source the phytoplankton​
    14·1 answer
  • How to prevent bias in scientific investigation
    13·1 answer
  • Paula finds four unlabeled containers of clear, odorless liquid in her laboratory storage. One of the containers holds water. Sh
    8·2 answers
  • Where to rescue workers get their energy
    10·1 answer
  • Name this tube like cavity? I think it’s the Esophagus.
    13·2 answers
  • True or false. Enzymes increase the activation energy (the energy needed to start a reaction) and speed up chemical reactions in
    12·2 answers
  • Do terrestrial dicot and monocot roots have root caps?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!