Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
This is only explanation. What are the questions for it?
Answer:
leave the nucleus, goe to the cytoplasm,bind to a ribosome to be read
Highlighted artery is right coronary.
<h3>
What is artery?</h3>
- The blood channels that carry oxygen-rich blood from the heart to the body's tissues are called arteries.
- Each artery consists of three layers and is a muscular tube bordered by smooth tissue.
- The endothelium, a smooth tissue, lines the intima, the inner layer.
- Blood is transported from your heart through arteries.
- All body parts have arteries, with the exception of the hair, nails, epidermis, cartilages, and cornea.
- In the limbs, they run along the flexor surface, where they are less vulnerable to injury, and the larger trunks typically occupy the most protected positions.
- A conduit that carries blood from the heart to the body's extremities is called an artery.
- Every artery, with the exception of the pulmonary artery, carries oxygenated blood.
- The ascending aorta, aortic arch, thoracic aorta, and abdominal aorta are the four divisions of the aorta, which is the biggest artery in the body.
Learn more about artery here:
brainly.com/question/14015132
#SPJ1