1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmasim [6.3K]
3 years ago
5

True/False (A= True & B =False) 46. Blood is a tissue. 47. Elastic cartilage is found in the ears, nose, epiglottis and lary

nx. 48. If you have a neoplasm you hope it is benign. 49. All cancers are neoplasms but not all neoplasms are cancer. 50. Plasma cells produce Histamine 51. The liver is one organ that can partially regenerate because it is made of epithelial cells 52. Keratin is a waterproofing protein found in epithelial cells
Chemistry
1 answer:
swat323 years ago
5 0

Answer:

46.A 47.B 48.B 49.A.50.A.51.B.52.B

You might be interested in
Im doing a science project and need examples and non-examples of an Atom. some examples of an atom is neon, hydrogen, argon, etc
gogolik [260]

Answer:

Anything not on the periodic table is an element non example! ... So, for a substance to be an element, all of its atoms must have the same number of protons. Examples of elements include hydrogen, lithium, nickel, and radium.

Explanation:

6 0
3 years ago
What is the similarity between radioactive iodine and stable iodine
Elena-2011 [213]

Answer:

both iodine

Explanation:

7 0
3 years ago
Which organ is most directly involved in the excretion of waste products? Please help
Shkiper50 [21]

Answer:

Explanation:

The liver

3 0
3 years ago
Read 2 more answers
Convert .006 km into cm​
Harrizon [31]

600 centimeteres

mark brainliest

3 0
3 years ago
Read 2 more answers
about the lung with balloons what respiratory organ do the small balloons represents? the big balloons?
butalik [34]

Answer:

The plastic bottle represents the chest cavity, the straws act as the bronchi, the small balloons inside the plastic bottle serves as the lungs and the big balloon at the bottom of the plastic bottle is the diaphragm.

Explanation:

7 0
3 years ago
Other questions:
  • Why is it important to analyze data?
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What is Magnesium? (Give me a straight answer plz)
    5·2 answers
  • Calculate the mass (in grams) of 8.56 moles of sulfur.
    13·1 answer
  • Pls help
    15·1 answer
  • Compound name for C3F8
    13·1 answer
  • What is true of all eukaryotic organisms?
    14·1 answer
  • URGENT A gas occupies a volume of 2.4 L at 0.14 ATM. What volume will the gas occupy at 0.84 ATM ?
    9·1 answer
  • Oxidation of Nitrogen in N2O3​
    10·1 answer
  • The moving of molecules from areas of high concentration to that of low concentration to gain energy is best described as
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!