1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex777 [14]
3 years ago
13

I NEED ANSWER IN 5 MINUTES THANKS :3

Biology
2 answers:
dsp733 years ago
6 0

Human body is made of ten different systems. All the systems require support and coordination of other systems to form a living and healthy human body. If any one of these systems is damaged, human body will become unstable and this lack of stability will ultimately lead to death. The instability caused by damage of one system cannot be stabilized by other systems because functions of one system cannot be performed by other systems. Knowledge of human body systems is very important for a medical professional because it is the base of all medical sciences and clinical practices. Although, generally, the structural aspects of human body systems are studied in anatomy and the functional aspects are studied in physiology but it is very important to have a coordination between the two subjects because knowledge of structure is incomplete without the knowledge of function and the knowledge of function is incomplete without the knowledge of structure.


Alborosie3 years ago
5 0
Can you show me a picture of the essay as I need to see what sort of thing you need
You might be interested in
Carlos was in a car accident and received a head injury that resulted in a decreased ability to produce speech. carlos has more
galina1969 [7]
The brain is a part of the central nervous system together with the spinal chord.
The other part of the nervous system is the peripheral nervous system which is consisted of nerves and ganglions. 
Humans own their ability of speech to the three areas in the brain. 
Broca's area is essential for forming words, Wernicke's area helps us understand the meaning of words and the arcuate fasciculus connects these two areas and gives speech coherence. 
7 0
3 years ago
Simple exocrine glands are found in the ___ glands in dogs.
seraphim [82]
Simple. exocine glands are found in the Adrenal. glands of dogs
4 0
3 years ago
Read 2 more answers
Why skeletal connective tissue is also known as supporting connective tissue.
ANEK [815]

Answer:

Supportive connective tissue—bone and cartilage—provide structure and strength to the body and protect soft tissues. A few distinct cell types and densely packed fibers in a matrix characterize these tissues. In bone, the matrix is rigid and described as calcified because of the deposited calcium salts.

Explanation:

7 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
What is translation, in biology
sergiy2304 [10]

Answer:

Translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a sequence of amino acids during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding amino acid sequence that it encodes.

7 0
3 years ago
Other questions:
  • What type of cell might be the result of mitosis
    7·1 answer
  • True or False - Velcro was an invention that was originally used for space missions that is now used for things on Earth.
    9·1 answer
  • A scientist discovers that a soil bacterium he has been studying produces an antimic robial that kills gramnegative bacteria. Sh
    12·1 answer
  • How does carrying capacity affect the exponential growth?
    9·2 answers
  • Plzzz....someone ....Diffusion
    12·1 answer
  • What do fossil fuels produce
    5·2 answers
  • What do the circled letters on the outside of the Punnett square in the attached figure represent?
    12·1 answer
  • Can someone please help me on this all u have to do is search up on the internet and then put down 4 facts that are mentioned in
    12·1 answer
  • Can the effects of UV light on folate explain the full variation of human skin color that exists among human populations today?
    13·1 answer
  • Any movement of bacteria seen under the microscope is motility?<br><br> true or false
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!