1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
3 years ago
11

Rat is an omnivores animals. True/False​

Biology
1 answer:
kondor19780726 [428]3 years ago
5 0

Answer:

True

Explanation:

Both mice and rats are omnivores, which means they eat plants and animals, but they tend to enjoy different food items.

You might be interested in
Bào quan nào sau đây đảm nhiệm chức năng tổng hợp và vận chuyển các chất?
Mandarinka [93]

Answer:

Trung thể.

Explanation:

3 0
3 years ago
Lime obtained from limestone is an important ingredient in the manufacture of cement. Would the Cayuga Lake Basin be a good or p
Kamila [148]

Answer:

Within the geological structure of Cayuga Lake Basin there is a diversity of limestone sources, which would make it possible for the lake to be a good location for the construction of a cement-making plant.

Explanation:

Cayuga Lake, part of the so-called Finger Lakes, located in New York, has an extension of about 40 miles. This lake is of great economic and ecological importance, because it allows fishing and recreation activities, besides being a place of passage for migratory birds.

The Skaneateles, Onandaga, Marcellus, Manilius, Moscow and Tully formations are an important source of limestone of variable quality, from which lime can be obtained for the manufacture of cement.

Although the presence of limestone would be ideal for building a cement-making plant, a project of this size should consider the environmental impact it could have.

Learn more:

brainly.com/question/13764464

4 0
4 years ago
When particles may flow freely you have a solid, liquid, or gas ? <br><br> I need the answer please
horrorfan [7]

Answer:

The answer is Gas.

Explanation:

Gas flows freely because the particles are loose and has no restraints.

4 0
3 years ago
Read 2 more answers
What has allowed animals to adapt over time?
jeka94

Natural selection ensures that animals with features that increase their chances of survival are more likely to live and pass those traits on to their progeny.

Animals adapt to their surroundings over a lengthy period of time, which causes those changes. The evolution of adaptations happens across many generations.

<h3>What is an adaptation?</h3>
  • A physical or behavioral characteristic of an animal that enhances its ability to survive in its environment is known as an adaptation.
  • To put it another way, an adaptation is something a species does or has on them that makes it easier for them to locate food, water, mates, and shelter.
  • Among the adaptations that helped animals live and prosper on land are:
  1. Gas exchange using a moist membrane
  2. The ability to traverse land (limbs instead of fins)
  3. The capability of body water conservation
  4. The capability of reproduction and early habitability
  5. The capacity to endure fast environmental changes
<h3>What are the types of adaptation?</h3>

Depending on the environment, there are three basic types of adaptations: behavioral, structural, and physiological.

  • Physiological- When an animal's body's internal mechanisms adapt to its surroundings.
  • Structural - Over the course of millions of years of evolution, the animal's bodily features alter.
  • Behavioral - Animals adjust their behavior in reaction to their environment.

To learn more about adaptations visit:

brainly.com/question/22557205

#SPJ1

6 0
1 year ago
Answer the following questions.
Dafna1 [17]

Answer: reading paper books and magazines,  sleeping in beds under cotton sheets, having a sandwich for lunch , sitting at wooden desks , I picking wildflowers , eating a favorite breakfast cereal.

Explanation: These are all correct because each has to deal with plants. For example, reading the paper books, sleeping in the bed and sitting at the wooden desk all have to due with the products that come from plants. Paper, cotton, and wood are all grown from plants and turned into resources. Next picking flowers, eating foods are also direct examples of how plants help us. Picking flowers that come directly from plants. Then eating food that is grown from plants shows that it is directly plants providing for humans.

6 0
3 years ago
Other questions:
  • This is any functional structure within the confines of a cell; literally a. Small organ; it usually has a membrane-based struct
    15·2 answers
  • What is the function of a negative regulator gene
    6·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Annelids are characterized by: (Select all that apply.) Group of answer choices ecdysis. hydrostatic skeletons. radula for feedi
    13·1 answer
  • What process is a mechanism in plants
    11·1 answer
  • Why isn't it possible for adenine to pair with cytosine<br> or guanine?
    9·1 answer
  • ANSWER ASAP Which factor determines the amount of gas that can dissolve in ocean water? (A) the motion of the air above the ocea
    13·1 answer
  • What of matter are always moving <br><br> True <br> Or<br> False
    12·1 answer
  • Need help with the top question :p
    6·1 answer
  • Which argument supports the idea that viruses are alive?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!