1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AlexFokin [52]
3 years ago
15

oldest fossils usually: _____.1. are found in the deepest strata 2. have the longest half-lives 3. are found in sediments formed

during the Cenozoic era 4. contain more radioactive isotopes than younger fossils 5. are found above younger fossils
Biology
1 answer:
Salsk061 [2.6K]3 years ago
5 0

Answer:

Option (1)

Explanation:

According to the law of superposition, the rocks that are found at the bottom of an undisturbed sedimentary sequence are the oldest rocks as these layers are initially formed due to the process of deposition, sedimentation and lithification, and with progressive sedimentation, the rock layers that are formed at the the apex portion are the youngest rocks.

So, the fossils found in bottom rocks are the oldest fossils, and those fossils that are found in the top layer are considered to be the youngest fossils.

Thus, the oldest fossils are the ones that are found in the deepest strata.

Therefore, the correct answer is option (1).

You might be interested in
WHEN ANIMALS EAT THE FOOD IS STORED AND DIGESTES IN THE STOMACH OR A SIMILAR STRUCTURE BUT WHEN A UNICELLULAR ORFANISM LIE THE P
BaLLatris [955]

They store food in a vacuole.

6 0
3 years ago
I need a poem about Photosynthesis and Cellular Respiration: has to have at least 20 lines and includes these words: ATP, Carbon
Neporo4naja [7]

Photosynthesis The Poem

I stand as a plant.

But what do I need?

I cannot make a sandwich

to feed.

But lucky for me

I have Photosynthesis, you see!

I take the Carbon Dioxide

And some water too

Altogether, I have Glucose for food

This gives me ATP energy

Which I need to survive

And so I do not come to my demise

But this also makes oxygen

Which I do not need

So I give it to humans so they can breathe.

Cellular Respiration is what they use

a little bit of oxygen

glucose tagging along too

they produce water and CO2

the mitochondria capture the energy

and use it

to power you so you can make tea!

My superpower may seem unreal

but it's not I promise

as crazy as it may feel.

My leaves grow big and strong

To reach out and soak up sunlight

that's far beyond.

I have organelles in my cells

that humans do not

They're called Chloroplasts just like you thought!

And they give me food like the chips you bought.

Chloroplasts take the suns light

And use it to make me food

like the glucose I eat every night!

Please don't laugh, I tried my hardest lol

Do whatever you'd like with it, take snippets of it or don't use it at all but either way I hope it helps a little!

4 0
3 years ago
Why are frameshift mutations likely to be more detrimental than point mutations
Galina-37 [17]

POSSIBLE ANSWERS:

* Because they are likely to change more than one amino acid

* Frameshift mutations are likely to change more than one amno acid because different set of codons read, nonsense codon could be introduced causing premature termination

HOPE THIS HELPS

4 0
2 years ago
A garden pea plant possesses one allele coded for yellow seed colour and one a coded for green seed colour. Which statement is t
schepotkina [342]
What are the statements? We can’t say which is true if we don’t know what the statements are
5 0
2 years ago
A scientist conducts an experiment to find conflicting data with a theory widely accepted. What should the scientist do?
Aleks [24]

Answer:

The scientist must complete the experiment, evaluate the results and disclose his conclusions.

Explanation:

If the scientist wishes to find conflicting data in a widely accepted theory, he must first establish a scientific experiment using all the steps of the scientific method. It is important for the scientist to complete the entire experiment so that he can evaluate the results and reach concrete conclusions about whether there is, in fact, conflicting data in the theory. The results should generate conclusions that must be disclosed regardless of whether the cinetist's hypotheses are proven or not.

The scientific method is a set of rules that guide the execution of a scientific experiment.

8 0
2 years ago
Other questions:
  • Events that damage the cell's regulatory apparatus, trapping it in the G1 phase of the cell cycle, cause the uncontrolled divisi
    5·2 answers
  • True or false. the liver is the organ that first receives glucose after it is absorbed into the bloodstream.
    8·1 answer
  • Which describes the notation Tt for being the trait of being tall
    14·1 answer
  • Help! Help! Easiest Help that can be given! Please answer all the questions!
    11·1 answer
  • Sensory organisms receive a stimulus
    5·1 answer
  • Do you think the generalization that all organisms are composed of cells was established using controlled experiments or multipl
    9·2 answers
  • When a resource is depleted quicker than it can be replenished, it is considered _______.
    5·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • PLEASE HELP
    15·1 answer
  • Yeah I have no questions man
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!