1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inessss [21]
3 years ago
7

two springs with constants k1 and k2 are in a series Using the fact that force balance must apply everywhere, what is the equiva

lent spring constant of a single spring? That is, if you had to swap out a single spring for the two springs that are in series, what would its spring constant need to be to generate the same force at any displacement?
Biology
1 answer:
aivan3 [116]3 years ago
7 0

Explanation:

Let the spring constant of two springs are k₁ and k₂. In series combination of springs, the equivalent of springs is given by :

k_{eff}=\dfrac{1}{\dfrac{1}{k_1}+\dfrac{1}{k_2}}

So, if it is required to swap out a single spring for the two springs that are in series, the spring constant need to be to generate the same force at any displacement is,

\dfrac{1}{\dfrac{1}{k_1}+\dfrac{1}{k_2}}

Hence, this is the required solution.

You might be interested in
You are conducting a twin study to estimate the heritability of a particular trait and have found that monozygotic twins have a
iogann1982 [59]

Answer:

The correct answer is "high heritability".

Explanation:

Concordance, is a term used in genetics to describe the probability that one of the twins have certain trait if his brother certainly has it. A high percentage of concordance, such as 75%, is translated into high heritability since monozygotic twins have identical genomic sequences. Additional information to determine heritability will be to study the exposure to similar environmental conditions, since environment can also affect the presence of certain traits.

4 0
2 years ago
The oil immersion objective is necessary to determine the morphology of prokaryotes
VLD [36.1K]
To clearly view the morphology of the prokaryotes, one needs a microscope with higher resolution i.e magnification of ×100. Use of oil for this purpose is important because it  reduces the refraction of light as it travels from air to glass. this process increases the resolution of the microscope making it possible to view morphology of bacteria.  
6 0
3 years ago
Read 2 more answers
A three-point testcross is used to determine the order of three linked genes. The following crossover progeny result: single cro
dusya [7]

Answer:

no

Explanation:

idc and idk this is stupid

5 0
3 years ago
What disease disables the bodys immune system??
larisa86 [58]
<span>Human immunodeficiency virus or better known as HIV disables the immune system </span>
5 0
3 years ago
The result of genes controlling mitosis not working properly is:
7nadin3 [17]

Answer:

d

Explanation:

This leads to unnecessary replication and out-of-control cell and tissue growth

7 0
3 years ago
Read 2 more answers
Other questions:
  • ____ on the blood determine a person’s blood type.
    12·2 answers
  • Jane is a researcher who studies the individual and collective aging processes in humans. jane works in the field of
    5·1 answer
  • The master gland is the _____, which secretes hormones that stimulate other glands of the body.
    11·1 answer
  • What is a Deciduous forest?
    9·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What's the relationship between photosynthesis and cellular respiration?
    10·1 answer
  • Pls help me with this giving Brainly
    7·1 answer
  • Define science 1-3 sentences thank you!
    12·1 answer
  • Selective breeding happens
    8·1 answer
  • when reading a book, the ciliary muscle will __________, the suspensory ligament will __________, and the lens will become more
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!