1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klasskru [66]
3 years ago
5

Inattentional blindness occurs when individuals do not observe certain objects or events because they are focused on something e

lse. true or false.
Biology
2 answers:
Kipish [7]3 years ago
6 0
True! because <span>Inattentional blindness occurs when individuals do not observe</span> visible objects in plain sight due to attention being focused else where.
Vitek1552 [10]3 years ago
4 0

Answer:

The given statement is true.

Explanation:

The intentional blindness refers to the condition in which an individual misses something in their line of the visual eye as he or she was focusing on something else, and thus, a new vision is not anticipated. It is a psychological condition in which an individual misses things, which are present right in front of his or her eyes.  The term intentional blindness was postulated by two psychologists, Irvin Rock, and Arien Mack.

You might be interested in
Soil formation is most influenced by _____.<br><br> A.climate<br> B.plants<br> C.wind<br> D.animals
Tems11 [23]
A. climate, because temperature and precipitation are directly related to how dry or fertile soil is
6 0
3 years ago
Read 2 more answers
One species called the naked mole-rat, has some unique differences. They have a social structure similar to that of ants and bee
Verizon [17]

Answer:

May be of the environment they live or genetics.

Explanation:

This naked mole rat species evolved back to an ectothermic life style rather than staying endothermic like all other mammals because of the environment they live or change in the genetic makeup. The main reason for this evolution may be the environmental they lives or through the change in genetic makeup of this naked mole rat species so both factors can contribute in the evolution.

8 0
3 years ago
Which of the following is FALSE about elements?
trapecia [35]

Answer:

I believe the answer to be E because it says atom and it is asking what is false about elements.

Explanation:

4 0
3 years ago
All of the ____ and things ____ in a particular area are called an ecosystem<br> fil in the blanks
andrew11 [14]

Answer:

living, nonliving

Explanation:

all living and non living things in an area make up an ecosystem

8 0
3 years ago
Clarify the relationship between photosynthesis and cellular respiration
Liono4ka [1.6K]

Answer:

Photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.

Explanation:

4 0
3 years ago
Other questions:
  • Precipitation moves down into the soil and becomes groundwater. Groundwater that travels into the saturated soil zone becomes pa
    14·2 answers
  • The general term given to male sex hormones is______?
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Heat is transferred from the sun to your skin by...?
    6·1 answer
  • Which statements describe adaptations necessary for plants to live on land? Check all that apply.
    6·1 answer
  • Why have some companies chosen to grow algae in bioreactors?​
    8·1 answer
  • Identify the types of genetic recombination.
    10·2 answers
  • Is anyone else 16-17? lets be friends lol
    11·1 answer
  • PLZZ PLZ PLZZ HELP
    14·1 answer
  • The arrangement of organs and tissues in their characteristic places in 3 - D space defines ______. A. pattern formation B. diff
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!