1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
atroni [7]
3 years ago
15

What is responsible for regulating temperature in the human body?

Biology
2 answers:
grandymaker [24]3 years ago
7 0
Hypothalamus regulates your temperature
Readme [11.4K]3 years ago
5 0

Answer:

The hypothalamus regulates your body temperature, responding to internal and external stimuli and making adjustments to keep the body within one or two degrees of 98.6 degrees.

Explanation:

According to google :)

You might be interested in
Х
Neporo4naja [7]

Answer:

biologie is klote, net zoals je nu doodgaat

5 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
What are two ways that variation can be described?​
Anna11 [10]

Answer:

Mutation and Recombination

6 0
3 years ago
What is the type of allele that only affects the phenotype in the homozygous condition?
sergeinik [125]
I thinking the answer was for some genes, both alleles express together. Others combine to give an average phenotype....
3 0
3 years ago
How are traits passed from parent(s) to offspring in sexual vs. asexual reproduction?
UkoKoshka [18]

Answer:

In sexual reproduction, traits will be taken from both parents, so the child will be a mix of traits from the father and the mother

In asexual reproduction, there is only one parent, so the child will be a genetical replica of the parent

5 0
3 years ago
Other questions:
  • Which of the following factors contributes to reemergence of disease more than the appearance of a new disease?
    6·2 answers
  • Macrosociology and microsociology approach the study of society from different perspectives. how does sociology, as a discipline
    12·1 answer
  • Warm waters rich in marine life would be classified as which of the following zones?
    12·1 answer
  • What color of light corresponds to the lowest amount of light absorbed?
    10·1 answer
  • Red blood cells are placed in a hypotonic solution.
    5·1 answer
  • What does adaptation mean
    12·2 answers
  • A researcher stimulates, with a small electrical charge, a portion of a cat's limbic system. The cat suddenly jumps and acts as
    8·1 answer
  • If Rh factor is present in blood???<br>is the blood group + ve or - ve???​
    8·2 answers
  • Help please! i'm not entirely bad at biology but things like this i don't know lol
    12·1 answer
  • A student drew the following model.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!