1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pachacha [2.7K]
4 years ago
10

physician assistants must complex medical issues in a way that____.They must also communicate with the doctors and other healthc

are workers to ensure that they provide the best possible patient care​
Health
1 answer:
Travka [436]4 years ago
5 0

Answer: Sign Language

Explanation:

You might be interested in
What are the things that you wanted to advice to young teens today about courtship?​
Alexxx [7]
Focus on yourself but not to the point where it’s selfish
3 0
3 years ago
It is easier to get motivated for physical activities when they are enjoyable. true or false
Natasha_Volkova [10]
True. When ur inspired or something looks fun, you wanna do it.
7 0
3 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
This system receives and transmits information and responses. It depends upon electrical impulses created by the movement of cha
34kurt
Brain? Nervous System?
4 0
3 years ago
Read 2 more answers
Please help!!!<br><br> which tool is used to lift and turn foods such as pancakes?
PolarNik [594]

Answer:

a spatula

Explanation:

I love spongebob, and ik from him :D

5 0
3 years ago
Other questions:
  • Who was the first to write about nerves in the teeth
    10·1 answer
  • Can investigate the function of tissues by scanning for a radioactive tracer:
    13·1 answer
  • Bert is four and a half. He is in speech therapy and early intervention. He has a vocabulary of about five hundred words. He is
    6·1 answer
  • What does rRNA stand for?
    9·2 answers
  • Kendra knows someone who suffers from overeating frequent consumption of alcohol and gambling what disorder does Kendra's friend
    8·2 answers
  • Fill out the required information using information from the lessons, "Infectious
    12·2 answers
  • How a threat is perceived triggers the secondary appraisal of a stressor
    10·1 answer
  • Give me mustard right now
    10·1 answer
  • A nurse is reviewing the medication administration record on four clients. The nurse should identify that which of the following
    13·1 answer
  • After suffering a stroke, mary finds that she cannot move her right arm. This would suggest that the stroke damage is in the are
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!