1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vika [28.1K]
4 years ago
15

Biology! URGENT! Write in complete sentences! In 5-6 sentences or more! PLEASE NEED HELP!!

Biology
2 answers:
Arte-miy333 [17]4 years ago
5 0

Answer:

See the answer below

Explanation:

In the case of cardiovascular diseases, the main causes are sedentary lifestyle, stress, nutrition (consumption of junk food and low consumption of high-fiber foods), diabetes, high blood pressure, overweight. In the case of poor nutrition, it happens that the increase in cholesterol that we call "bad" LDL occurs and the "good" HDL cholesterol that is protective and sweeps the bad that covers the blood vessels is not increased. Taking into account diabetes, the excess glucose produced in the body, glycosylates the LDL particle, which also obstructs the passage of blood flow through the vessels.

Vedmedyk [2.9K]4 years ago
4 0
I believe it is prevalent in the USA because we are a country based on capitalism. This means that we will do pretty much anything for the money. This includes selling things that are unhealthy and can clog our arteries. Heart disease could affect other organs because some need blood to function. Without blood, it can’t function, meaning it’s will shut down.
You might be interested in
What does the word “corona” mean? How does this relate to the ability of the virus to adhere to other cells?
Andrew [12]

Answer:

the word means the ceremony of crowning a sovereign or a sovereign's consort.

it kills peopel

Explanation:

4 0
3 years ago
When did the mass extinction occur? (Name the era and period)
kherson [118]

Answer:

Explanation:

The first mass extinction is called the Ordovician-Silurian Extinction. It occurred about 440 million years ago, at the end of the period that paleontologists and geologists call the Ordovician, and followed by the start of the Silurian period. In this extinction event, many small organisms of the sea became extinct.

6 0
3 years ago
Incomplete dominance is a _____ of two phenotypes, but codominance is a _____ of two phenotypes.
Galina-37 [17]

both alleles in the heterozygous genotype are exhibit in the phenotypes.  Allele is completely dominant over the other, and  it is the phenotype is a blend of the two homozygous phenotypes, there are more than two forms of the same gene, and there maybe one more superior form and several different phenotypes

5 0
3 years ago
Need help with number 31:
Whitepunk [10]

Answer:

its C.specific sequences bases in DNA reproductive cells.

Explanation:

8 0
3 years ago
Read 2 more answers
Which of the following would most likely result in the greatest decrease in the rate of a chemical reaction ?
g100num [7]
<span>Most likely result in the greatest decrease in the rate of a chemical reaction would come from the correct posting of all your answer choices available</span>
5 0
3 years ago
Other questions:
  • Compared to an adult, a newborn breathes
    8·2 answers
  • Fermentation supplies ....blank..... ATP molecules beyond that obtained by glycolysis
    9·1 answer
  • Memories result in the formation of new neurons. true or false
    7·2 answers
  • Carlsbad Caverns is unusual because the cave was originally carved from _________.
    7·1 answer
  • Which organism needs care from its parents after birth? A. frog B. turtle C. mouse D. snake
    8·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • ?hormones that cause increased activity in the ovaries and testes are known as
    6·1 answer
  • This illustration shows a kind of animal that is a free-living organism.
    13·2 answers
  • *lf a strand has 35% adenine, what percent will be cytosine?
    14·1 answer
  • The bed of a large pickup truck has a carrying capacity of 2. 5 cubic yards. How much is the capacity in cubic inches?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!