1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
4 years ago
11

How is most of the oxygen on Earth produced?

Biology
1 answer:
Irina18 [472]4 years ago
5 0
In the process of photosynthesis, phytoplankton release oxygen into the water. Half of the world's oxygen is produced via phytoplankton photosynthesis. The other half is produced via photosynthesis on land by trees, shrubs, grasses, and other plants.
You might be interested in
Child has blood types b, rh–, and m. his mother has blood types o, rh+, and mn. give the genotype of the mother, and the possibl
Makovka662 [10]
I don't even know the answer sorry
8 0
4 years ago
Wich bread molds the fastest rye or white bread?
Eduardwww [97]
The white bread will mold the slowest because there is less density
8 0
4 years ago
How are water resources used and managed?
KIM [24]
Wells, tube-wells, rivers, lakes, dams etc. Methods of management of water resources include rainwater harvesting, construction of bawris and khadins and water harvesting structures on the level terrain.
6 0
3 years ago
Read 2 more answers
Help last question on test. 50 POINTS !!!!!!!
CaHeK987 [17]
As the cells multiply they get slower
8 0
3 years ago
Read 2 more answers
What did antione lavoisier do (what was his work)
marin [14]
He recognized and named Oxygen as well as hydrogen. 
8 0
3 years ago
Read 2 more answers
Other questions:
  • For a cell with 22 chromosomes state how many chromatids
    13·1 answer
  • What do you think? Should human activity should
    11·1 answer
  • 20 POINTS PLEASE HELP ASAP!
    11·1 answer
  • Imagine a pool ball that bounces off of a bumper and
    13·1 answer
  • What is indicated by two species having similar amino acids in the hemoglobin protein?
    11·1 answer
  • Topsoil is the horizon in Figure 7-1.
    14·2 answers
  • Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
    5·1 answer
  • Related to finale: three months later, you can see that the spots in the mri appear to be smaller. using what you know about the
    12·1 answer
  • Help!! Plsss ASAP really neee it
    14·1 answer
  • As with any major scientific discovery, the previous work of many different scientists help contribute to final conclusions. Whi
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!