Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
The volume that sulfur dioxide will occupy with a volume of 652 mL at 40.0°C and 0.75 atm is 0.019moles. Details about volume can be found below.
<h3>How to calculate volume?</h3>
The volume of a gas can be calculated using the following formula:
PV = nRT
- P = pressure
- V = volume
- n = number of moles
- R = gas law constant
- T = temperature
0.75 × 0.652 = n × 0.0821 × 313
0.489 = 25.69n
n = 0.489/25.69
n = 0.019moles
Therefore, the volume that sulfur dioxide will occupy with a volume of 652 mL at 40.0°C and 0.75 atm is 0.019moles.
Learn more about volume at: brainly.com/question/1578538
#SPJ1
Answer:
The volume of the gas sample at standard pressure is <u>819.5ml</u>
Explanation:
Solution Given:
let volume be V and temperature be T and pressure be P.
1 torr= 1 mmhg
42.2 torr=42.2 mmhg
so,
Now
firstly we need to find the pressure due to gas along by subtracting the vapor pressure of water.
=735-42.2=692.8 mmhg
Now
By using combined gas law equation:
Here 
are standard pressure and temperature respectively.
we have
Substituting value, we get
Answer:
Zn+2HCl→ZnCl2+H2
Explanation:
Hydrogen gas is prepared in the laboratory by reacting dilute HCl with granulated zinc.
