1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marishachu [46]
3 years ago
11

Now that Terrell is in his 20s, he only dates other guys. He did have a girlfriend in high school but was never sexually attract

ed to her. His sexual orientation is _____.
Biology
1 answer:
NNADVOKAT [17]3 years ago
3 0
He’s sexual orientation would be homosexual
You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Statement #1: Cells are the building blocks of life. <br><br> Agree or Disagree?<br><br> Evidence:
ladessa [460]
Agree, the cells are the basic unit of life therefore it’s agree. The cell is the basic unit or cell of any organism.
8 0
3 years ago
The climate on the Moon is harsh because _____. the Moon has very little atmosphere the Moon is too close to the Sun the Moon is
Novay_Z [31]
The correct answer to the question which is stated above is obviously the first option: <span>the Moon has very little atmosphere

</span>The climate on the Moon is harsh because  the Moon has very little atmosphere. The moon can never<span> be too close or too far because it is right next to earth. </span>
6 0
3 years ago
Read 2 more answers
Does female sperm and male sperm look different
nikdorinn [45]

Answer:

the Y chromosome is smaller than the X chromosome.

Explanation:

The male has an X and Y sex chromosome which is an exception to the general rule that homologous chromosomes are identical as the Y chromosome is smaller thus enabling it to swim faster than the X chromosome. The Y chromosome also has a longer lifespan compared to the X chromosome. The male genotypes is XY. Males are heterogametic as they produce two types of gametes, one carrying the X and the other carrying a Y chromosome.

7 0
3 years ago
What is the difference in the function of the proteins and the carbohydrates attached to a cell membrane? What is the difference
densk [106]
Smooth er has less things inside of it and rough is more complex.
8 0
3 years ago
Other questions:
  • What causes finger to look wrinkled after soaking in water
    9·2 answers
  • In an energy pyramid, which level has the least available energy?*
    12·2 answers
  • How many factors does a scientist want to differ between the experimental and control groups?
    9·1 answer
  • Which statement is true? A.Simple sugars are made of polysaccharides. B.Amino acids are made of proteins. C.DNA molecules are ma
    13·1 answer
  • Mutation is an important mechanism for evolutionary change. Which type of mutations contribute to evolution?
    6·1 answer
  • Steroid hormones bind to receptors in the nucleus of their target cells. cannot diffuse through cell membranes. remain in circul
    11·1 answer
  • The spinal cord begins at the Select one: a. cerebellum. b. medulla oblongata. c. foramen magnum. d. conus medullaris e. 1st cer
    9·1 answer
  • Mutations in what class of genes have probably been responsible for many of the changes leading to the great diversity of life e
    7·1 answer
  • What will i do to meet my goals?​
    7·2 answers
  • Part B: Determine Trait Variation in the Species
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!