1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bezzdna [24]
3 years ago
7

Does your zodiac sign affect your personality

Biology
2 answers:
tamaranim1 [39]3 years ago
6 0
It is said to differ your personality traits, but I don't believe that it could be possible.
Elena L [17]3 years ago
4 0
It depends on what you believe. Because your zodiac sign is based off your date of birth it is said that it defines your personality. I don`t believe in it but that is just my opinion.
You might be interested in
consider other shapes for a cell besides a cube? what cell shape might increase . surface area and decrease the volume explain
Vaselesa [24]
Answer - Well to put it in short terms. 

Cells such as water cells or aquatic microorganisms need and required to have a large surface area increased. Because this helps them stay afloat without spending much amount of energy to float.

6 0
3 years ago
In Gottlieb's model, the probabilistic aspect of development refers to the idea that the characteristics of organisms at any poi
alexira [117]

Answer:   Determined by genetic and environmental factors.

Explanation:

Are determined by genetic and environmental factors and the interaction of such factors, but not with absolute certainty. This development system model includes both influences of species typical genes and the influences of a species typical rearing environment.   Relatively rapid increase in obesity, the change stems from changes in the environmental context.

6 0
3 years ago
14. Which is true about a dependent variable in an experiment?
Grace [21]

c. It never changes during the experiment.

3 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Luke poles of magnets attract each other true or false ​
Gelneren [198K]

Answer:

yes, like poles can attract each other

Explanation:

this is when a magnet is one side north and the other south. They dont attract and repel when it it (north,north) and (south, south)

6 0
3 years ago
Other questions:
  • A close and permanent association between organisms of different species is called
    5·1 answer
  • Which of these bones is not a long bone found in the leg:?
    10·1 answer
  • Duchenne muscular dystrophy is a serious condition caused by a recessive allele of a gene on the human x chromosome. The patient
    7·1 answer
  • During an extended low-calorie diet (near fasting, the body increases the utilization of as a source of energy?
    15·1 answer
  • Where in a plant cell is glucose produced ?
    6·1 answer
  • PLEASE HEP ME FAST!
    7·1 answer
  • If a scientists data was contaminated what is the best course of action
    12·1 answer
  • Which process will decrease the level of co2 in the atmosphere?
    5·2 answers
  • Which best describes the importance of mitosis to living organisms
    15·1 answer
  • PLEASE HELP!!
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!