1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
In-s [12.5K]
3 years ago
12

Explain how to change the physical states of the substance

Biology
1 answer:
Mashcka [7]3 years ago
4 0

Answer:

We can change the physical state of a substance by heating or cooling it.  For example, liquid water can be heated to convert it into the gaseous form i.e steam. Steam can be cooled or condensed to convert it into liquid water.

Liquid water can be cooled to convert it into the solid physical state which will be ice. Ice can be heated to convert it into liquid again. Hence, we can change the physical states by heating or cooling a substance.

You might be interested in
The process that moves large bodies of earth materials to higher elevations is called​
Alexxx [7]

Answer:

The process that moves large bodies of earth materials to higher elevations is called <em>Uplift</em><em>.</em>

8 0
3 years ago
Examples of hypothesis ​
FromTheMoon [43]

Answer:

Here are some examples of hypothesis statements:

If garlic repels fleas, then a dog that is given garlic every day will not get fleas.

Bacterial growth may be affected by moisture levels in the air.

If sugar causes cavities, then people who eat a lot of candy may be more prone to cavities.

3 0
3 years ago
Read 2 more answers
A diseased cell is no longer able to produce proteins. Which cell structure is most likely malfunctioning?
Zina [86]
The ribosomes are most likely malfunctioning.
3 0
3 years ago
Read 2 more answers
I need help does anybody knows the answer
Marat540 [252]
C i think





let me know if i was right :)
8 0
2 years ago
If you could live on Jupiter, what would you see in the sky at night besides stars?
schepotkina [342]

Answer:

many moons

Explanation:

None of Jupiter's moons have more than traces of atmosphere, so their skies are very nearly black. ... For an observer on Io, the closest large moon to the planet, Jupiter's apparent diameter would be about 20° (38 times the visible diameter of the Moon, covering 5% of Io's sky).

3 0
2 years ago
Other questions:
  • if natural selection operates to select for a specific trait which statement must be true about that trait for evolution to occu
    12·2 answers
  • BRAINLIESTTT ASAP!!!
    7·1 answer
  • Which of the following is an assumption of continuity theories?
    6·2 answers
  • What is the main purpose of the executive branch of government?
    9·1 answer
  • What can fossils tell us about Geologic history?​
    10·1 answer
  • At a fault block, one portion of the block moves upward while the adjacent portion moves downward. What is the upper portion cal
    14·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • i dont understand i dont understand i dont understand i dont understand i dont understand i dont understand i dont understand i
    7·1 answer
  • Can someone help me if this is correct
    8·1 answer
  • Grows and regresses (it's shed) with each monthly cycle
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!