No they are two different environments with different factors
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
C) all the offspring will be genetically identical.
Explanation:
During binary fission, all the offspring will be genetically identical and little to no variation occurs.
Binary is an asexual form of reproduction which does not involve the combination of gametes from the parents.
- During binary fission, the parent simply divides to produce young ones.
- In this process, the offspring replicates the genetic component of the parents making it identical.
- The offspring is a direct copy of the parents.
- It is only in sexual reproduction that genetic materials are exchanged between the parents and offspring. This leads to genetic variation.
Learn more;
Asexual reproduction brainly.com/question/9424950
#learnwithBrainly
