1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aksik [14]
4 years ago
5

A habitat contains all of the abiotic and

Biology
2 answers:
Hatshy [7]4 years ago
4 0

Answer:

Agree

Explanation:

The biotic factors of an ecosystem include all the populations in a habitat, such as all the species of plants, animals, and fungi, as well as all the micro-organisms. Also recall that the nonliving factors are called abiotic factors. Abiotic factors include temperature, water, soil, and air.

Leokris [45]4 years ago
3 0
Agree as a habitat is a place of living and survival for an organism, therefore providing it with all essentials and needs to survive
You might be interested in
A favorable energetic process has an overall negative Gibbs free energy change (ΔG). As a protein folds, amino acid chains can h
IgorLugansk [536]

Answer:

The process that balance the the unfavourable entropic contribution from protein folding is the rearrangement  of the water molecules around it.

Explanation:

Proteins are often in aqueous solutions. And around the protein, the water molecules are distributed in the way thermodynamically most favorable. So, the water molecules interact with the aminoacidic residues of the protein, making posible for the macromolecule to exist in solution.

During protein folding, are formed several interactions among the aminoacidic residues, which are responsible for the structure the protein adopts.

At the beginning it might seem this process shouldn't be possible, as the transition from one state to another more ordered one isn't spontaneous.

But as these new interactions are formed, an enormous amount of water molecules that were interacting with the protein are "released", being able to adopt several more configurations, in other words, gaining entropy.

In summary, the reduced entropy from the protein folding is balanced by the gain in entropy by the water molecules in the surrounding medium, which allows the process to occur.

6 0
3 years ago
Which is not an input into the Calvin-Benson cycle?
Rufina [12.5K]
H2O is not an input into the Calvin-Benson Cycle
4 0
3 years ago
Burning fossil fuels releases oxides of sulfur and nitrogen. these air pollutants can be responsible for question 5 options:
aev [14]
Most likely A or E.. not completely sure but A and E<span />
3 0
4 years ago
Describe the events that take place during Prophase – I of meiosis.
Scilla [17]

leptotene : homologus pairing is formed  and chromosomes start to get closer to each other.

zygotene: synapsis is formed between homologus chromosomes  which is apoint oattachment.

pachytene:crosing over occer that homologus chromosomes exchange THIER GENETIC METERIALS.

DIPLOTENE: chiasmata formation disapear which was formed in pachytene.

diakinasis:homologus chromosomes start to seperate from each other.

8 0
3 years ago
According to Whittaker’s system of classification, which of the following is not a kingdom? Monera Algae Fungi
miss Akunina [59]
The correct answer is the second option, algae. Algae is definitely not considered a kingdom. Algae is a group under the Kingdom Plantae. This organism is completely a diverse group of photosynthetic organisms that are not completely close or related to each other. 
4 0
4 years ago
Other questions:
  • What is the definition of a gene pool
    13·1 answer
  • Jackie read that Aloe vera promote healing of burned tissue. She decided to investigate the effect of varying amounts of Aloe ve
    15·1 answer
  • What is the basic unit of structure and function of all living organisms?
    11·2 answers
  • Certain insects resemble the twigs of trees. Based on modern evolutionary theory, the most probable explanation for this is that
    12·1 answer
  • What is the role of the vacuole in plant cells?
    11·2 answers
  • Why do all the planets in the solar system orbit the sun in the same direction ?
    12·1 answer
  • What was the main point of paragraph 3
    8·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Name three characteristics of life.
    15·1 answer
  • How do impulses travel from one neuron to the next?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!