1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lera25 [3.4K]
3 years ago
6

Rachael wants to test how sunlight impacts plant growth over time. She will add varying amounts of light to different sets of pl

ants. What is the independent and dependable variable?
Biology
1 answer:
Mrrafil [7]3 years ago
4 0

Answer:

Independent variable: varying amounts of light

Dependent variable: plant growth

Explanation:

The variable, which are factors that can be altered, in an experiment can either be independent or dependent. An independent variable is one in which the experimenter manipulates or controls in order to bring about an outcome. For this experiment conducted by Rachel, the independent variable is the VARYING AMOUNT OF LIGHTS.

The dependent variable is the variable that responds to changes of the independent variable. In other words, the dependent variable is the outcome of manipulating the independent variable. Hence, the dependent variable is dependent on the independent variable. For Rachel's experiment, the PLANT GROWTH is the dependent variable because it is what responds to changes in amount of light (independent variable).

You might be interested in
This macromolecule is composed of carbon, hydrogen and oxygen but is not a lipid
ratelena [41]

Answer:

If the macromolecule is not lipid, then IT'S CARBOHYDRATE

5 0
3 years ago
Internal membrane connected to the external membrane where energy production may occur and which may help cell division
Paha777 [63]
Mitochondria are unusual organelles. They act as the power plants of the cell, are surrounded by two membranes, and have their own genome. They also divide independently of the cell in which they reside, meaning mitochondrial replication is not coupled to cell division. Some of these features are holdovers from the ancient ancestors of mitochondria, which were likely free-living prokaryotes.
4 0
3 years ago
Glycerophospholipids can interact both with other lipids and water because they contain both __________ and __________
USPshnik [31]

Answer:

polar regions and nonpolar regions

Explanation:

if right braniliest? I only need one more

7 0
2 years ago
The principle of independent assortment involves at least how many different gene pairs?.
Flura [38]

Independent assortment occurs spontaneously when alleles of at least two genes are assorted independently into gametes.

5 0
2 years ago
I’m which part of the cell is the majority of the energy released from breakdown of glucose
poizon [28]

Sentence Correction: In which part of the cell is the majority of the energy released from the breakdown of glucose?

nucleus

mitochondrion

cytoplasm

plasma membrane

Answer: <em>The answer is mitochondrion.</em>

Explanation: <em>The reason the is the correct answer is because, there are the Locations of Cellular Respiration which occurs in two stages.</em>

<em>First stange - cytoplasm</em>

<em>Second stage - mitochondrion</em>

<em>So as we can see, mitochondrion is the Second stage which is the correct answer because the majority of the energy released from the breakdown of glucose.</em>

<em />

6 0
3 years ago
Read 2 more answers
Other questions:
  • What type of mutation cannot happen in a child after birth ?
    12·1 answer
  • What conditions would cause an increase in the salinity of ocean water?
    7·2 answers
  • WHAT ARE THE CELLS CALLED THAT HOLD ALL YOUR MEMORIES RECENT AND DISTANT
    6·1 answer
  • Dolphins (which are mammals) and sharks (which are fish) have stiff dorsal fins projecting from their backs that help them maneu
    6·1 answer
  • What feature is common to prokaryotic and eukaryotic cells?
    14·2 answers
  • Topic: Enzymes and germinating seeds
    8·1 answer
  • It’s cooking <br><br><br> Can someone plz help me it’s due today. If you can’t read it let me know
    5·1 answer
  • 2 When molecules are spread evenly across the cell ________ membrane,
    8·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • In the diagram below of a human skeleton, what is the name of the bone
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!