Covalent compounds are composed of atoms that are linked via covalent bonds i.e. bonds formed by mutual sharing of electrons. This is in complete contrast to ionic compounds which are held together by ionic bonds, i.e. bonds formed by complete transfer of electrons from one atom to the other.
In the given examples we have:
Barium nitrate: Ba(NO3)2 - Ionic
Dinitrogen tetroxide: N2O4- Covalent
Boron trifluoride: BF3-Covalent
Ammonium sulfate: (NH4)2SO4- Ionic
Carbon tetrachloride: CCl4- Covalent
Barium chloride: BaCl2 - Ionic
Answer:
36.66%
Explanation:
Step 1: Given data
- Mass of the sample: 2.875 g
Step 2: Calculate the mass of salt
The mass of the sample is equal to the sum of the masses of the components.
m(sample) = m(iron) + m(sand) + m(salt)
m(salt) = m(sample) - m(iron) - m(sand)
m(salt) = 2.875 g - 0.660 g - 1.161 g
m(salt) = 1.054 g
Step 3: Calculate the percent of salt in the sample
We will use the following expression.
%(salt) = m(salt) / m(sample) × 100%
%(salt) = 1.054 g / 2.875 g × 100% = 36.66%
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
The difference in the number of protons and neutrons in atoms account for many of the different properties of elements.
