1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alukav5142 [94]
3 years ago
14

What is answer for each questions?

Biology
1 answer:
disa [49]3 years ago
5 0

Answer:

15 B

16 C

17 B

18 A

Explanation:

In my opinion these are 100 percent sure answer

You might be interested in
One of the most important factors in determining the rate of weathering _____.
Sergeeva-Olga [200]

Answer:

Is the type of rock

Explanation:

8 0
3 years ago
What cell organelle is responsible for the liberation of energy from carbohydrates?
Marysya12 [62]
The mitochondrion!!! Of course!!
7 0
4 years ago
Besides anger other emotions that can impair your ability to drive include
Burka [1]
---------___euphoria___------------                                                                            
3 0
3 years ago
Question in picture
zepelin [54]
Pretty sure it’s convection
7 0
3 years ago
A chronic neurological disease that involves an imbalance of the levels of neurotransmitters, dopamine, and acetylocholine, is c
SVETLANKA909090 [29]
<span>Parkinson's Disease if im wrong tell me</span>
3 0
3 years ago
Other questions:
  • Label each level of dna packaging in the eukaryotic chromosome with the appropriate term.
    11·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following is not caused by human interactions with the earth system
    13·2 answers
  • Why body system is dependent on a constant supply of iron, and what deficiency is caused when this mineral is lacking?
    8·2 answers
  • 1. By examining the fin of a primitive fish, scientists
    12·1 answer
  • Predict the effects of the following types of gene mutations on the protein encoded by that gene (your answer can be just a few
    6·1 answer
  • How are protozoa similar to animals?
    15·1 answer
  • Will give brainliest<br> What is this?
    5·1 answer
  • Most igneous activity takes place?
    11·2 answers
  • Which of the follwing functions at the same organizational level as the kidneys in the human excretory system?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!